ID: 1024457320

View in Genome Browser
Species Human (GRCh38)
Location 7:49624136-49624158
Sequence TCTGTGTGTGCTCATTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024457320_1024457323 28 Left 1024457320 7:49624136-49624158 CCTCAGGAATGAGCACACACAGA No data
Right 1024457323 7:49624187-49624209 AGCATTTGTAAGCCAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024457320 Original CRISPR TCTGTGTGTGCTCATTCCTG AGG (reversed) Intergenic
No off target data available for this crispr