ID: 1024458797

View in Genome Browser
Species Human (GRCh38)
Location 7:49638489-49638511
Sequence CATGAGCAGCACAGCCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024458797_1024458804 30 Left 1024458797 7:49638489-49638511 CCTATATGGCTGTGCTGCTCATG No data
Right 1024458804 7:49638542-49638564 GTAGCAAGAAAAGTGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024458797 Original CRISPR CATGAGCAGCACAGCCATAT AGG (reversed) Intergenic
No off target data available for this crispr