ID: 1024459510

View in Genome Browser
Species Human (GRCh38)
Location 7:49645512-49645534
Sequence CTGGCTGTGCAGATGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024459505_1024459510 -2 Left 1024459505 7:49645491-49645513 CCCTACAGTGTCTGCAAAGCACT No data
Right 1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG No data
1024459503_1024459510 12 Left 1024459503 7:49645477-49645499 CCCTGACTGAAACTCCCTACAGT No data
Right 1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG No data
1024459504_1024459510 11 Left 1024459504 7:49645478-49645500 CCTGACTGAAACTCCCTACAGTG No data
Right 1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG No data
1024459502_1024459510 27 Left 1024459502 7:49645462-49645484 CCAGGTGGTGTGAGACCCTGACT No data
Right 1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG No data
1024459501_1024459510 28 Left 1024459501 7:49645461-49645483 CCCAGGTGGTGTGAGACCCTGAC No data
Right 1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG No data
1024459506_1024459510 -3 Left 1024459506 7:49645492-49645514 CCTACAGTGTCTGCAAAGCACTG No data
Right 1024459510 7:49645512-49645534 CTGGCTGTGCAGATGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024459510 Original CRISPR CTGGCTGTGCAGATGTAGGG AGG Intergenic
No off target data available for this crispr