ID: 1024460914

View in Genome Browser
Species Human (GRCh38)
Location 7:49658539-49658561
Sequence CATGTTATGAGATGTGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024460914_1024460916 0 Left 1024460914 7:49658539-49658561 CCTGGTACACATCTCATAACATG No data
Right 1024460916 7:49658562-49658584 GTATACATCTTTAAGTACTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024460914 Original CRISPR CATGTTATGAGATGTGTACC AGG (reversed) Intergenic
No off target data available for this crispr