ID: 1024471798

View in Genome Browser
Species Human (GRCh38)
Location 7:49773955-49773977
Sequence GCCAGGCGGAGCGCGCAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024471791_1024471798 -6 Left 1024471791 7:49773938-49773960 CCTAGCCCGGTGTGCGCGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 155
1024471788_1024471798 5 Left 1024471788 7:49773927-49773949 CCCAGAGACGCCCTAGCCCGGTG 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 155
1024471787_1024471798 6 Left 1024471787 7:49773926-49773948 CCCCAGAGACGCCCTAGCCCGGT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 155
1024471789_1024471798 4 Left 1024471789 7:49773928-49773950 CCAGAGACGCCCTAGCCCGGTGT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 155
1024471790_1024471798 -5 Left 1024471790 7:49773937-49773959 CCCTAGCCCGGTGTGCGCGCCAG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024471798 Original CRISPR GCCAGGCGGAGCGCGCAGGT GGG Exonic
900032438 1:381235-381257 GCCAGGCGGCCGGCGCACGTGGG + Intergenic
900120422 1:1046483-1046505 GCCAGGGGGAGGGCGCCGGGGGG - Exonic
900138531 1:1128985-1129007 GGCAGGCGGAGCCCGCGGGGAGG + Intergenic
900227566 1:1540231-1540253 GCCAGGCGGCGCGCGCGGGCGGG + Intronic
902053777 1:13583922-13583944 GCCTGGAGGAGCGCGACGGTGGG - Exonic
913610142 1:120503022-120503044 GCCAGGGGGCGCTCACAGGTGGG - Intergenic
914581048 1:149019217-149019239 GCCAGGGGGCGCTCACAGGTGGG + Intronic
916660772 1:166920915-166920937 TCCAAGCGGAGCGCGCAGCTCGG - Exonic
922806968 1:228395177-228395199 GACAGGCGGAGCGTGCAGCGGGG - Exonic
922917648 1:229271383-229271405 GGCTGGCGGGGCGCGCGGGTCGG + Intronic
923053230 1:230403598-230403620 TCCAGGCGGAGCACTCAGGATGG - Intronic
923158285 1:231297119-231297141 GCCAGGCGGGAAGGGCAGGTTGG - Intergenic
1062880345 10:973224-973246 GGCAGGGGGAGCTCGCAGGGTGG + Intergenic
1062969334 10:1634093-1634115 GACAGGCGCAGAGGGCAGGTGGG - Intronic
1063539604 10:6918956-6918978 ACTAGGCAGAGCGGGCAGGTTGG + Intergenic
1064645316 10:17454105-17454127 GCCAGGCGGGGCGCGCGGCGCGG + Intronic
1066930215 10:41749529-41749551 GCCAGACAGTGGGCGCAGGTCGG + Intergenic
1066963647 10:42242477-42242499 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1072638107 10:97190275-97190297 GCCAGGAGGAGTGCCCAGGATGG - Intronic
1075849382 10:125574736-125574758 GCCAGGCGTAGTGCCCAGCTGGG + Intergenic
1076624250 10:131811844-131811866 GCCAGGGTGAGCTGGCAGGTTGG + Intergenic
1076815718 10:132913848-132913870 TTCAGGTGGAGCGCGCAGGCCGG - Intronic
1076900675 10:133336031-133336053 GCTGGGGGGTGCGCGCAGGTGGG + Intronic
1077094469 11:793430-793452 GACAGGCAGAGCCCCCAGGTGGG + Intronic
1077132587 11:980623-980645 GCCAGGAGGAGCGGGGAGGGAGG + Intronic
1077134939 11:993806-993828 GACAGGAGCAGCGCGCGGGTGGG - Exonic
1077247639 11:1547226-1547248 GCCCCGCGGCGCGCGCAGGTTGG + Intergenic
1077532452 11:3103611-3103633 GCCAGGCAGAGGGAGCAGGTGGG - Intronic
1078174969 11:8963817-8963839 GGCTGGCGGAGGGCGCAGGTGGG + Intronic
1083679180 11:64343443-64343465 GCCAGGCCGAGTGTGTAGGTCGG - Intronic
1084199365 11:67545162-67545184 GGCAGGCACAGCGGGCAGGTGGG - Intergenic
1084480356 11:69416250-69416272 GGCAGGCGGCGTGTGCAGGTTGG + Intergenic
1085417342 11:76328130-76328152 GCCAGGCGGAGGGAGGGGGTTGG + Intergenic
1089153970 11:116386301-116386323 GCCTGACGGAGCACGCAGGTGGG + Intergenic
1092256410 12:6928526-6928548 GCCAGGCAGAGCCCGCAGTGGGG - Intronic
1094155583 12:27333629-27333651 CCGCGGTGGAGCGCGCAGGTGGG + Intronic
1095951977 12:47786522-47786544 GCCAGGCGGTGCGGGGAGTTGGG - Intronic
1096708927 12:53441516-53441538 GCTAGGCGGAGAGCGCTGGAGGG - Intergenic
1096779744 12:53984995-53985017 GGCAGGCGGAGCGCGCAGAGTGG - Intergenic
1099989537 12:89708511-89708533 GCCAGGCGGAGCACGGAGGTCGG - Intronic
1101376016 12:104172244-104172266 GGCAGGCGGAGGGCGGAGCTAGG + Intergenic
1103161195 12:118730709-118730731 GCCAGGCTGAGTGCCCAGGTGGG + Intergenic
1105881076 13:24607080-24607102 ACCAGCCGGAGTGCTCAGGTCGG + Intergenic
1112652730 13:101416392-101416414 GCCAGGCGCGGCGCCCAGGGCGG + Intronic
1113874412 13:113585185-113585207 GTCGGCCGGAGCGCGCAGGGCGG + Intronic
1121758663 14:96424223-96424245 GCCGAGCGGAGCGCGCAGCCGGG + Intronic
1122082392 14:99274632-99274654 GCGAGGTGGAGCGCGCCGGCGGG - Intergenic
1122692045 14:103536101-103536123 ACCAGGGGCAGAGCGCAGGTAGG - Exonic
1123790407 15:23714193-23714215 GCCAGACAGTGGGCGCAGGTCGG + Intergenic
1124469350 15:29969040-29969062 GCCCGGCGGCGCGCTCCGGTGGG + Intergenic
1126852500 15:52805780-52805802 GCCAGGGCCCGCGCGCAGGTCGG - Intergenic
1127454286 15:59143337-59143359 GCCGGGAGGAGTGGGCAGGTGGG + Intronic
1128139252 15:65286998-65287020 GCCGGGCGGAGCGCGGCGGCGGG - Intronic
1132512789 16:352575-352597 TCCACGCGGAGCGGGCGGGTGGG - Exonic
1132659810 16:1056237-1056259 GGCAGCAGGAGCACGCAGGTGGG + Intergenic
1132807659 16:1782509-1782531 GGCCGGCGGAGCGCGCAGCGGGG - Exonic
1133156615 16:3880578-3880600 GCCGGGCGGAGCGGGCCGGCCGG + Exonic
1133219988 16:4315826-4315848 GCCAGGCGGGGCGTGCGCGTCGG - Intronic
1133298730 16:4768744-4768766 GCGAGGCGGGGCGCGCATGCGGG - Intergenic
1135805979 16:25543094-25543116 GCCAGGCTGAGGGAGCAGGTTGG - Intergenic
1136724809 16:32349002-32349024 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1136843135 16:33555041-33555063 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1137270961 16:46901952-46901974 GCCAGGCAGAGGGTGCAGGGGGG - Intronic
1139530015 16:67538175-67538197 GGCAGGCGGAGCCCGCACCTCGG + Intronic
1139754579 16:69132362-69132384 GCCGGGCGGGGCGCGCGGCTCGG - Intronic
1140712810 16:77694019-77694041 GGCAGAGGGAGCGCCCAGGTGGG - Intergenic
1141682572 16:85553221-85553243 GCCCGGCGGGGCGCGCGGGGTGG + Intergenic
1141946230 16:87311562-87311584 CCCTGGCGGAGCACACAGGTTGG + Intronic
1142156381 16:88534491-88534513 GGCAGGCCGAGCGCGCCGGGCGG - Exonic
1142308862 16:89300451-89300473 GCCAGGCTGTGCTCGCAGGCGGG - Intronic
1203001621 16_KI270728v1_random:168753-168775 GCGAGGCGGGGCGCGCGGGGAGG + Intergenic
1203133224 16_KI270728v1_random:1705159-1705181 GCGAGGCGGGGCGCGCGGGGAGG + Intergenic
1203153300 16_KI270728v1_random:1855339-1855361 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1142852868 17:2712565-2712587 TCCAGGCAGAGAGCGCCGGTGGG + Intronic
1143629055 17:8126682-8126704 GGGAGGCGGAGCGCGCCGGAAGG - Intergenic
1143749950 17:9021149-9021171 GCCCGGGGGAGCGCGCGGGCGGG - Intergenic
1147648891 17:42050746-42050768 GCCGGGCTGAGCGCGCTGGGCGG - Intronic
1151581611 17:74982382-74982404 GCCGGGCTGCGCGCGGAGGTAGG + Intergenic
1152747874 17:82049570-82049592 GCCCGGCTGAGCAGGCAGGTGGG - Intronic
1152824873 17:82458531-82458553 GCCAATCGGAGCGCGCGGGGCGG - Intronic
1160024906 18:75209172-75209194 GCCAGGGGGAGGGCGCCGGCCGG - Exonic
1160236095 18:77087854-77087876 GGCAGCAGGAGCGCGCAAGTGGG - Intronic
1160809713 19:1008104-1008126 GCCAGGCGGTGGGGCCAGGTGGG - Intronic
1161312893 19:3604552-3604574 GGCAGGCGGGGCGGGCAGGGTGG - Intronic
1165233848 19:34404798-34404820 CACCGGCGGTGCGCGCAGGTAGG + Exonic
1165333756 19:35155234-35155256 GCCTGGCGGAAGGCGCAGGGAGG + Exonic
1165479499 19:36054294-36054316 GGCAGGCGGCGAGCGCGGGTGGG - Exonic
1165742795 19:38213596-38213618 GCCAGGCGGGGCGGGCAGCAGGG + Intronic
1165913211 19:39242516-39242538 GCCAGGGGGAGCGCTCACCTTGG + Intergenic
1165917912 19:39272224-39272246 GCCAGGGGGAGCGCTCACCTTGG - Intergenic
1166106778 19:40601553-40601575 GCGTTGCGGGGCGCGCAGGTCGG - Intronic
1168059263 19:53882283-53882305 GCCAGGGGGAGCGGGCGAGTGGG - Exonic
924987913 2:288184-288206 GCCAGGCGCAGCGCGCTCGGCGG - Exonic
925348812 2:3187702-3187724 GTCAGGAGGGGCGTGCAGGTGGG - Intergenic
931937290 2:67213634-67213656 GCCAAGCTGAACTCGCAGGTAGG - Intergenic
936279168 2:111122719-111122741 GCCCGGCGGAGCGCGGCGGCGGG + Intronic
936388803 2:112054612-112054634 GCCAGGCCGAGCGTGGAGGCGGG - Intergenic
936388847 2:112054744-112054766 GCCAGGCCGAGCGTGGAGGCGGG - Intergenic
936388933 2:112054988-112055010 GCCAGGCCGAGCGTGGAGGCGGG - Intergenic
938259221 2:129883300-129883322 GGCAGGCAGAGCCCTCAGGTTGG - Intergenic
941804297 2:169694669-169694691 CCCATGGGGAGCGCGCAGGTGGG - Exonic
947506768 2:230713388-230713410 GCCGGGCGGAGAGGGCAGGCTGG - Intronic
1169128370 20:3147632-3147654 GCCAGGCCCAGCAGGCAGGTGGG + Exonic
1170868998 20:20187328-20187350 GCCAGGGGCAGGGAGCAGGTAGG + Intronic
1171188041 20:23137383-23137405 GTCAGGCTCAGCGGGCAGGTGGG - Intergenic
1171346435 20:24469567-24469589 CGCAGGCGGAGAGCGCAGGGCGG + Exonic
1172232690 20:33347787-33347809 GCCAGCTGGAGCTCGCAGATAGG + Intergenic
1172389750 20:34558839-34558861 GCCCGGCTGGGCGCGCAGGCCGG - Intronic
1174480263 20:50826282-50826304 GCCAGGCAGAGCGTGGAGCTGGG + Intronic
1175950640 20:62581428-62581450 CCCAGGGGGTGCGCGCAGGCTGG - Intergenic
1179585159 21:42370102-42370124 GTCAGGGGCAGCGGGCAGGTGGG - Intergenic
1180138250 21:45875242-45875264 GTCAGCCGGAGCGCGCAGCACGG - Intronic
1182211367 22:28679910-28679932 GCGAGGCGGGGCGCGCGGGGAGG - Intergenic
1182748449 22:32623555-32623577 GCCAGGCAGGGCAGGCAGGTTGG - Intronic
1183465434 22:37977985-37978007 GCGAGGCGGAGTGCCCCGGTGGG - Exonic
1185127699 22:49021051-49021073 GCCAGGCAGAGCAGGGAGGTTGG - Intergenic
1185375630 22:50481614-50481636 GCAAGGCGGAGCGGGCTGGGCGG - Exonic
953614422 3:44477561-44477583 GCCTGGCGGGGCGCGGGGGTGGG - Intronic
954646648 3:52135742-52135764 GCCAGGCTGAGGGCTGAGGTAGG - Intronic
954710144 3:52501527-52501549 GCCAGGCAGAGCAGGGAGGTGGG + Intronic
958641748 3:96814454-96814476 GCCAGGTGGGGCGGGCAGTTGGG - Intergenic
961827205 3:129605418-129605440 AGCAGGCGGTGCGCGCAGCTCGG + Exonic
963247855 3:143079240-143079262 GCCAGACGGAGGGCACAGGCTGG + Intergenic
968135402 3:196216645-196216667 GGCAGGCGGGGCGGGCAGGTGGG - Exonic
982746009 4:159104066-159104088 GGCGGGCGCAGCGCGCAGGGCGG + Intergenic
989146833 5:38258171-38258193 GGCAGGAGGAGGGCCCAGGTGGG + Intergenic
990428587 5:55712492-55712514 GGCAGCCGGCGCGCCCAGGTGGG + Exonic
992813027 5:80408237-80408259 GCCAGACCCAGCGCCCAGGTCGG - Intronic
994185006 5:96807479-96807501 GCCAGGCGGAGCGCTGAGGGAGG + Intronic
997454077 5:134004791-134004813 GCCGGGCCGGGCGCGCAGGAGGG - Intronic
997843106 5:137260186-137260208 GCCAGGAGGAGGGCTGAGGTGGG - Intronic
997984662 5:138492597-138492619 TCCAGGCGGAGGGGGCAGCTCGG - Intergenic
999868613 5:155728217-155728239 GCCAGCCGGAGCGCGCACACCGG + Intergenic
1002741382 5:181437633-181437655 GCCAGGCGGCCGGCGCACGTGGG - Intergenic
1006774791 6:36583944-36583966 GCCGGGCGGATCACGGAGGTCGG - Intergenic
1006860818 6:37170604-37170626 GCAGGGCGCGGCGCGCAGGTGGG - Exonic
1007344943 6:41222453-41222475 GCCAGGAGGAGGGAGCAGGCTGG + Intergenic
1011999671 6:93637463-93637485 GCCAGACGGCGGGCGCAGATCGG - Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1017073768 6:150599972-150599994 CCCGGGCGGCGCTCGCAGGTCGG - Exonic
1017950142 6:159129283-159129305 GCCAGGCCAAGCGCACAGGCCGG - Intergenic
1019050236 6:169176982-169177004 GCCAGGAGGAGGGTGCTGGTGGG + Intergenic
1019447388 7:1078495-1078517 GGCAGGCGCTGCGCTCAGGTGGG + Intronic
1023594486 7:41814769-41814791 GCCTGGTGGAGCTCTCAGGTGGG + Intergenic
1024262208 7:47581488-47581510 TCCAGGTGGAGAGCGCAGCTAGG - Intronic
1024471798 7:49773955-49773977 GCCAGGCGGAGCGCGCAGGTGGG + Exonic
1025850499 7:65239776-65239798 GCCAGGCTGAGCGCGAGGGCGGG + Intergenic
1035501623 8:94563-94585 GCCAGGCGGCCGGCGCACGTGGG + Intergenic
1037768871 8:21787571-21787593 GCCAGGCGCGGCTGGCAGGTGGG + Intronic
1039212844 8:35235894-35235916 GCTGGGCGGAGCGGGCAGCTGGG + Intronic
1041544867 8:59031741-59031763 TCCAGACTGAGCGAGCAGGTTGG + Intronic
1041557538 8:59174534-59174556 GCCAGACAGTGGGCGCAGGTCGG - Intergenic
1042722514 8:71841691-71841713 GCGCGGAGGAGCGCGCAGGGTGG - Exonic
1044822103 8:96161389-96161411 GCCAGGCGCAGGGCCCAGCTCGG + Intergenic
1045555049 8:103207650-103207672 GGCAGGGGGAGGGGGCAGGTGGG + Intronic
1048882587 8:138883077-138883099 GCCAGGCTCAGCGGGCAGGTGGG - Exonic
1051774922 9:20622568-20622590 GCGGGGCGGAGCGCGCGGGGAGG + Intergenic
1053057101 9:34999789-34999811 GCTAGGCAGAGCCCGCAGATGGG - Intergenic
1056970140 9:91194819-91194841 GGCAGGCGGATCACGCAGTTAGG - Intergenic
1061181701 9:129028314-129028336 GCCAGCCCGAGCGCGCAGGGCGG + Intergenic
1061620272 9:131807318-131807340 GCCTGGAGGAGAGCGCCGGTGGG + Intergenic
1061680722 9:132241343-132241365 GCGAGACGGAGCTGGCAGGTGGG + Intronic
1062070808 9:134554080-134554102 GCCTGGCGGAGTGAGCAGGGGGG + Intergenic
1062347675 9:136122904-136122926 GCCAGGCCGGGGGCGCAGGAAGG - Intergenic
1062367307 9:136216981-136217003 GCGAGGCCGTGGGCGCAGGTGGG - Intronic
1062425316 9:136503553-136503575 GCCAGGGAGAGCGCGTTGGTGGG - Intronic
1062653578 9:137590587-137590609 GCGGGGCGGCGCGCGCCGGTCGG - Intergenic
1203607293 Un_KI270748v1:68849-68871 GCCAGGCGGCCGGCGCACGTGGG - Intergenic
1185506876 X:638390-638412 GACAGGCGGAGAGTCCAGGTGGG + Intronic
1187419576 X:19122624-19122646 GCGAGGCTGGGCGCGGAGGTGGG + Intronic
1189848555 X:45157881-45157903 GCCAGGCCCTACGCGCAGGTGGG + Exonic