ID: 1024472158

View in Genome Browser
Species Human (GRCh38)
Location 7:49775407-49775429
Sequence CCACGTCCCGGCGGGCGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024472158_1024472169 5 Left 1024472158 7:49775407-49775429 CCCGCCCGCCCGCCGGGACGTGG 0: 1
1: 0
2: 4
3: 23
4: 180
Right 1024472169 7:49775435-49775457 GATGCCCAGCTCCACTGCGATGG 0: 1
1: 0
2: 0
3: 15
4: 161
1024472158_1024472172 12 Left 1024472158 7:49775407-49775429 CCCGCCCGCCCGCCGGGACGTGG 0: 1
1: 0
2: 4
3: 23
4: 180
Right 1024472172 7:49775442-49775464 AGCTCCACTGCGATGGCAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024472158 Original CRISPR CCACGTCCCGGCGGGCGGGC GGG (reversed) Exonic
900349261 1:2227251-2227273 CCAGGGGCCGGCGGGCGGGGCGG + Intergenic
900715237 1:4139887-4139909 CGACATCCCTGCGGGTGGGCAGG + Intergenic
902072179 1:13749499-13749521 CCGGGGCCGGGCGGGCGGGCCGG - Intronic
902476479 1:16691250-16691272 CCACCTCCAGGCGGGCATGCTGG + Intergenic
902476734 1:16692457-16692479 CGGCGGGCCGGCGGGCGGGCGGG + Intergenic
902585785 1:17438105-17438127 CTCCCTCCCGGCGGCCGGGCCGG - Intronic
902979178 1:20110748-20110770 TCACGTCCTGGCCTGCGGGCTGG + Intergenic
903324869 1:22563845-22563867 CCTCGGCCCGGGGGGCGGGGTGG + Intronic
904252974 1:29237794-29237816 CGAGGGGCCGGCGGGCGGGCAGG + Intronic
908195470 1:61742679-61742701 CCCACTCCAGGCGGGCGGGCGGG - Intronic
909548000 1:76868482-76868504 CCATGGCGCTGCGGGCGGGCGGG - Exonic
912381461 1:109250052-109250074 CCAGCTCCCGGCCGGCGGCCGGG - Exonic
916963205 1:169909773-169909795 CCAGGTCCCGACGGGCTGCCCGG - Intergenic
920171238 1:204073580-204073602 CCGCGACGCGGCGGGCGGGCCGG - Intronic
921472652 1:215567519-215567541 CACCTTCCCGGCGGCCGGGCGGG - Exonic
922518104 1:226223424-226223446 CGCCGTCCGGGCGGGTGGGCGGG + Intergenic
1063944807 10:11165858-11165880 ACCTGTCCCGGCGGGCAGGCGGG - Intronic
1064074766 10:12259881-12259903 CCAAGTCACTGCGAGCGGGCAGG + Intergenic
1067406720 10:46030352-46030374 CCCGGGCCCGGCGGGCAGGCAGG + Intronic
1070305321 10:75235802-75235824 CCTGGTCCCGGCGGGCGGGTGGG - Intronic
1070336022 10:75455818-75455840 CCACCTCCTGGAGGGAGGGCAGG + Intronic
1073465629 10:103693228-103693250 CCGCGGGCGGGCGGGCGGGCGGG - Intronic
1074592049 10:114822267-114822289 CCACGACCCGGCGGCCGCCCAGG - Intronic
1075417025 10:122271696-122271718 CAAGGTCCCTGTGGGCGGGCAGG - Intronic
1075802289 10:125160758-125160780 CCCCCTCTCGGCGGGCGGGAGGG - Intronic
1076384281 10:130045728-130045750 CCACGTCCCGCCACGCGGGCGGG + Intergenic
1076558934 10:131348405-131348427 CCAGGTCCCGGGGCGAGGGCAGG + Intergenic
1076882857 10:133248040-133248062 CCAGGGCCCGCCGGGCGGGCGGG + Intergenic
1076921636 10:133457433-133457455 CCACGTCCCGGCGGGGGGCCTGG - Intergenic
1077062646 11:624640-624662 CCACGTCCCGGAGGGCCAGGAGG - Exonic
1077074874 11:695800-695822 CGACGGACCGGCGGGCGGGGCGG + Exonic
1078216323 11:9314731-9314753 CCTCTTTCCCGCGGGCGGGCCGG - Exonic
1078561719 11:12378046-12378068 CCACGGCCCGGCGGGGGCGTTGG - Intronic
1079023144 11:16925155-16925177 CCACGGCCCCGCAGGCGTGCGGG - Intronic
1082010946 11:47449233-47449255 CCACGTCCCAGCTCGCGGGTGGG - Intergenic
1083228767 11:61301745-61301767 CCACCTCCAGGGGGGCGGGGAGG + Intronic
1083743517 11:64723104-64723126 CCGCGGCGGGGCGGGCGGGCGGG - Exonic
1083886129 11:65574317-65574339 CCCCGCCCCGGCGGGACGGCAGG - Intergenic
1083936588 11:65872809-65872831 CCGCGCCGCGGCAGGCGGGCGGG - Exonic
1084186641 11:67476190-67476212 CCCAGGGCCGGCGGGCGGGCCGG - Intergenic
1084192240 11:67504486-67504508 CCAGGCTCCGGCCGGCGGGCGGG + Intronic
1084643809 11:70442649-70442671 CCAGGGCCTGGCGGGCGGGGTGG + Intergenic
1086950173 11:92883275-92883297 CCACGCCCCGCCGGGCTGTCAGG - Exonic
1087141467 11:94768988-94769010 CCAGAGCCCGTCGGGCGGGCCGG - Intronic
1088754937 11:112877968-112877990 ACACTTCCCGGCGGGGGGGTGGG + Intergenic
1090818143 11:130315930-130315952 CCAGGTGCCTGGGGGCGGGCGGG + Intergenic
1091857785 12:3753164-3753186 GCACGTCCCGGAGGGCGTCCAGG - Intronic
1097872071 12:64610336-64610358 CCACCTGCGGGCGGGCGGGGAGG + Intergenic
1102046616 12:109833486-109833508 CCGCGAGCCGGCGGGTGGGCGGG - Intergenic
1102768493 12:115452883-115452905 CCTTGTCCCTGCAGGCGGGCCGG - Intergenic
1103363971 12:120369219-120369241 CCCCGCTCGGGCGGGCGGGCGGG + Intergenic
1103504591 12:121433323-121433345 CCACAGGCTGGCGGGCGGGCAGG - Intronic
1104977912 12:132560395-132560417 GCACGTGGCGGCGGGCGGGCGGG + Intronic
1105049777 12:133037856-133037878 CCACGGCGCGGCAAGCGGGCTGG - Exonic
1107603905 13:42040475-42040497 CCTCCTCCCGGCGGGTGGCCCGG - Intronic
1110596598 13:77326802-77326824 CCTCGTCCCCGCGGGCCGGGCGG + Intronic
1111842037 13:93461652-93461674 CTAGGTCCCGGCGGGGGGGTTGG + Intronic
1112344009 13:98576286-98576308 CCACCCCCGGGCAGGCGGGCGGG - Intronic
1114473737 14:22980757-22980779 CCAGGTGCCCGCGGGCGGGGCGG - Intronic
1114483316 14:23048273-23048295 ACACGTCTCGGCGCGCGGGAGGG + Exonic
1114645650 14:24254717-24254739 CCACGTCAAGGAGAGCGGGCAGG - Exonic
1119087999 14:71754473-71754495 CAAGGTCCCGGGGTGCGGGCAGG + Intergenic
1121473470 14:94174298-94174320 GCACGGCCCGGCGAGGGGGCGGG - Exonic
1122399449 14:101458388-101458410 TCACCCCCAGGCGGGCGGGCCGG + Intergenic
1122880852 14:104689851-104689873 CCAGGTGGCGGCGGGCGGTCCGG + Intronic
1122917393 14:104865385-104865407 GCTCGGCCGGGCGGGCGGGCGGG + Exonic
1126767034 15:52019570-52019592 CCAGGCCCGAGCGGGCGGGCAGG - Intronic
1126852469 15:52805668-52805690 CCACATCCCGGCGGGCCGCCAGG - Intergenic
1128737659 15:70062363-70062385 CCCCTTGCAGGCGGGCGGGCAGG + Intronic
1129823759 15:78621006-78621028 CCAGGCGCGGGCGGGCGGGCGGG + Exonic
1130076601 15:80695290-80695312 CCTCCTGCCGCCGGGCGGGCGGG + Exonic
1131054797 15:89368843-89368865 CCAAGAGCCGGCGGGTGGGCGGG + Intergenic
1132365182 15:101251746-101251768 CCGCGTCCCCGCGCGCGAGCGGG - Exonic
1132459135 16:41637-41659 CCACGTCCCGGCGCCCTGTCCGG + Intergenic
1132591471 16:728101-728123 CGTGGTCCCTGCGGGCGGGCGGG - Exonic
1132879489 16:2155731-2155753 ACACGTCCCGGCGGGCGCAGCGG + Intronic
1132925905 16:2429122-2429144 GCGCTTCCCGGCCGGCGGGCAGG - Intergenic
1135549241 16:23385626-23385648 ACACATCCCAGCGGGCCGGCAGG - Intergenic
1136927521 16:34388609-34388631 CCAGGGACGGGCGGGCGGGCTGG + Intergenic
1136977053 16:35023197-35023219 CCAGGGACGGGCGGGCGGGCTGG - Exonic
1137280686 16:46973818-46973840 CCAGGTCCAGGCGGCTGGGCAGG + Intergenic
1139584539 16:67893393-67893415 CGACGGCCCGACGGGCGGGAGGG + Intronic
1140221663 16:73048333-73048355 CCGGGTCCCTGCGGGCGGGCGGG - Exonic
1141054781 16:80804624-80804646 CCCCGCCCCGGGGGCCGGGCCGG - Intergenic
1142120356 16:88383707-88383729 GCACGCCCGGGCGGGCGGCCCGG - Intergenic
1142211743 16:88811731-88811753 CGACCTCCGGGCGGGCGGGGCGG - Intronic
1143503111 17:7350294-7350316 CCACGTTCGGGCGGGCGGGCGGG + Intronic
1147728547 17:42582085-42582107 CCTCGTCCCGGCTGGCAGGTGGG + Exonic
1147935086 17:44006546-44006568 CCAGGTCCAGGTCGGCGGGCAGG - Exonic
1148685376 17:49497676-49497698 GCGCGTCCCGGCGGGTCGGCTGG + Intronic
1148818310 17:50346282-50346304 CGACGGCCGGGCGGGCGGGCAGG + Intronic
1149614644 17:57988008-57988030 CCCCGGGCTGGCGGGCGGGCGGG - Intronic
1150643623 17:66965232-66965254 ACACTGCCCGGCGCGCGGGCCGG + Intronic
1151612156 17:75183113-75183135 CCTCTTCCCGCCGGCCGGGCGGG - Intergenic
1152245382 17:79182537-79182559 CAACGCCCCGGCCGGCCGGCGGG + Intronic
1153872542 18:9334496-9334518 CTGCGGGCCGGCGGGCGGGCGGG + Intergenic
1160773457 19:844025-844047 CCTCATCCAGGTGGGCGGGCAGG + Exonic
1160775518 19:853400-853422 CCAGGTGCCGCCGGGCGGGGCGG + Exonic
1161729050 19:5947733-5947755 CCACGTCCCTGCCGGCGGGGTGG + Intronic
1161752934 19:6110566-6110588 CCCCGCCCCGTCGGGCGGGCGGG - Intronic
1161961626 19:7526603-7526625 CCAGGTGCTGGTGGGCGGGCAGG + Exonic
1162948485 19:14057383-14057405 CCACCTCCCGGCGCGCGGCGCGG + Exonic
1163577193 19:18117887-18117909 CCGCGTGCCGGCGAGTGGGCGGG - Intronic
1166090323 19:40504129-40504151 GCAGGTGCCGGCGGGGGGGCGGG + Exonic
1166717453 19:44977544-44977566 CCAAGTCCAGGAGGGCAGGCAGG + Intronic
1167313930 19:48753044-48753066 CCACGCCCCAGCGGCTGGGCAGG + Exonic
1167575133 19:50314384-50314406 GCACCTCCCGGGGGTCGGGCTGG - Intronic
1168337654 19:55605584-55605606 CCGCTTCCGGGCGGGCGGGCAGG + Intronic
1202710498 1_KI270714v1_random:17091-17113 CCACCTCCAGGCGGGCATGCTGG + Intergenic
925158775 2:1667045-1667067 CCACGTCCCTGCAGGTGGGCTGG - Intronic
926724165 2:15984522-15984544 CCACGGCCGGGCAGGCGGGCGGG - Intergenic
933751170 2:85602740-85602762 CCACGTCCCGGCGGGCGGCGCGG - Intronic
935555437 2:104504890-104504912 CCACGTCCTGGCAGGGGGACGGG - Intergenic
936046773 2:109194564-109194586 TCAGGGCCCGGCGGGCGGGCTGG + Intronic
936278736 2:111120808-111120830 TCCCGCCCCGGCGCGCGGGCTGG - Intronic
937221726 2:120346034-120346056 AGCCCTCCCGGCGGGCGGGCGGG + Intergenic
942046013 2:172100060-172100082 CCACGTGGGGGAGGGCGGGCAGG + Exonic
947718236 2:232352416-232352438 CCTCGGGCCGACGGGCGGGCGGG - Intergenic
948479058 2:238239318-238239340 CCGCGTCCCCGCGGGCCGGGTGG - Intronic
948596470 2:239082642-239082664 CCACGTGCCTGCAAGCGGGCAGG - Intronic
948901971 2:240960688-240960710 CCACGCCCCAGAGGCCGGGCCGG + Intronic
1169065689 20:2693172-2693194 CCGCGGGCGGGCGGGCGGGCGGG + Intronic
1169914902 20:10674463-10674485 CGAACTCCCGGCGGGCAGGCAGG - Intergenic
1170581699 20:17704165-17704187 CCACTTCCTGGTGGGTGGGCAGG + Intronic
1170999050 20:21395988-21396010 GCACGGCCCGGGGGGCGGCCTGG - Exonic
1172676613 20:36677132-36677154 CCCCTTCCCAGCTGGCGGGCTGG + Intronic
1172684828 20:36745859-36745881 CCTGGGTCCGGCGGGCGGGCGGG + Intronic
1174386847 20:50192364-50192386 CCAGGCGCCGGCGGGCGGGCCGG + Exonic
1176145463 20:63563454-63563476 CCACGCCCTGGCAGGCCGGCCGG - Exonic
1176234860 20:64049456-64049478 CACAGTCGCGGCGGGCGGGCGGG + Exonic
1179567135 21:42256266-42256288 CCACCTCCTGGCGGGAGGGCAGG - Intronic
1180609526 22:17086086-17086108 CCACTACCCGGCAGGCGGGTGGG - Intronic
1182586509 22:31346711-31346733 CCCCGGCCCCGCGGGCGGGGTGG - Intergenic
1183149808 22:36028624-36028646 CGACAACCCGGCGGGCGGGCGGG - Intergenic
1183504665 22:38202432-38202454 CCCCTTCCCGGGGCGCGGGCGGG + Intronic
1184030730 22:41892878-41892900 CCACATCCCAGCAGGAGGGCAGG - Intronic
1184369051 22:44070993-44071015 CCAGGCCAAGGCGGGCGGGCAGG - Intronic
1184698060 22:46150649-46150671 CCAGGTGCCCGGGGGCGGGCGGG + Intronic
1185333442 22:50261623-50261645 CCAGCGGCCGGCGGGCGGGCGGG - Exonic
1203261302 22_KI270733v1_random:172943-172965 CCGCGTCGCGGTGGGGGGGCGGG - Intergenic
950510037 3:13420424-13420446 CCGCGTCCCTGCGCGAGGGCCGG - Intergenic
951080483 3:18445336-18445358 CCACACCCCGGCCGGCGCGCTGG - Intronic
955368771 3:58333093-58333115 GCGCGGCCCAGCGGGCGGGCGGG + Intronic
955769304 3:62372806-62372828 CGACGCTCCGGCGCGCGGGCAGG + Exonic
961163654 3:124750027-124750049 CCCCGTCCCGGAGGGAGGGGGGG - Intergenic
961451634 3:127004815-127004837 CCAGGTCCCGCCTGGCAGGCGGG + Intronic
966985436 3:185175707-185175729 CCACGTCCCGGCGGAGGCCCTGG + Intergenic
968618574 4:1593265-1593287 CCACGTCCCCGCGCGCCCGCAGG + Intergenic
968651936 4:1763593-1763615 CCACCGCAGGGCGGGCGGGCGGG + Intergenic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
976765482 4:88593169-88593191 CCACTTCGCGGAGGCCGGGCCGG + Intronic
983904537 4:173169511-173169533 CCACTCCCCGGCGGGCGGGCCGG - Intronic
984966387 4:185143612-185143634 CCGCGGGCGGGCGGGCGGGCGGG - Intronic
994497832 5:100535714-100535736 CCACGGCCCGGCTGCTGGGCAGG - Exonic
996948155 5:129094666-129094688 CCGCGAGCTGGCGGGCGGGCTGG + Intergenic
997305097 5:132830710-132830732 CCACGTCCGGCCGCGGGGGCGGG + Exonic
997433520 5:133857919-133857941 CCACTTCCCAGCGGGGCGGCTGG + Intergenic
998200392 5:140113936-140113958 TCACGTGCCGGCGGGCGGGTGGG + Intronic
998406764 5:141878530-141878552 CCACCTCCCGGCCGGAGGGGGGG - Intronic
1002368385 5:178730416-178730438 CCAGATCCCGGCGCGGGGGCCGG + Intronic
1002385049 5:178860243-178860265 CCAAGTCCTGGCGCGGGGGCCGG - Intronic
1002474497 5:179456302-179456324 CTTCGTCTCAGCGGGCGGGCTGG + Intergenic
1002927645 6:1614281-1614303 CCCTGTCCCCACGGGCGGGCTGG + Intergenic
1003073031 6:2959579-2959601 CCACGTGCGGGCAGGCGTGCAGG - Exonic
1003290604 6:4776071-4776093 CCACGTCGAGGCGGGCTGGGGGG + Intronic
1004216952 6:13711830-13711852 CTGTTTCCCGGCGGGCGGGCCGG + Intergenic
1004923859 6:20401518-20401540 CGCCGGCCCGGCGGGCGGGCGGG + Intergenic
1005709469 6:28489818-28489840 CCACGTCCCGGTGGTGGGGGGGG + Intergenic
1006671410 6:35731845-35731867 CCGCGTCCTAGGGGGCGGGCGGG + Intergenic
1016728940 6:147407051-147407073 CCCAGTCCCCGCGGGCGTGCAGG - Intergenic
1017880610 6:158560239-158560261 CCCCGGCCGAGCGGGCGGGCTGG + Intronic
1017880672 6:158560442-158560464 CCGCGGCCGGGCGGGCAGGCAGG - Intronic
1019453089 7:1109753-1109775 CCAGGGCCCGGCGGGCGGGAAGG - Intronic
1019917780 7:4144534-4144556 CCACCTCCCAGATGGCGGGCTGG + Intronic
1020003222 7:4767349-4767371 CCTCGGCCCTGCGGGCGGCCTGG + Exonic
1022089094 7:27096300-27096322 CCACCTCCCGGAGGCCTGGCGGG - Intergenic
1024472158 7:49775407-49775429 CCACGTCCCGGCGGGCGGGCGGG - Exonic
1029110529 7:98211311-98211333 GCACCTGCGGGCGGGCGGGCGGG - Intergenic
1030033341 7:105388540-105388562 CCCCGGGCCGGCGGGCGGGCTGG - Intronic
1031051867 7:116953406-116953428 CCGCGTCCCCGGCGGCGGGCGGG + Exonic
1032013617 7:128361783-128361805 CCACACCCGGGCGGGCAGGCAGG + Intergenic
1032914894 7:136478745-136478767 CCACGTGCCGGGGGGAGGGGGGG + Intergenic
1034129296 7:148699864-148699886 CCAAGTCCCAGCGGCCTGGCGGG - Intronic
1034908544 7:154972999-154973021 CCGCGTCCAGGCAGGTGGGCGGG - Intronic
1034963087 7:155374352-155374374 GGGCGGCCCGGCGGGCGGGCCGG + Intergenic
1036706339 8:11049655-11049677 CCACCTCCCCGTGGGCTGGCAGG + Intronic
1041693596 8:60714079-60714101 CCAGGCCTCGGCGGGCGGGGTGG + Intronic
1042591588 8:70403009-70403031 CCGCGGCCCGGCGGGTGGCCCGG - Intronic
1044674986 8:94719826-94719848 CCGCGTCCCCGCAGGCGGCCCGG - Intronic
1045737927 8:105318486-105318508 CCTCGCCCCGGCGTGCGGGACGG - Intronic
1048214345 8:132481142-132481164 CCCCGTCGCGGCGGGAGGCCCGG + Intergenic
1048995066 8:139789174-139789196 CCACGGCCTGCCCGGCGGGCGGG + Intronic
1049109441 8:140634468-140634490 CCCCGTCCCAGCGGCCAGGCCGG + Intronic
1050526161 9:6548672-6548694 CCAGGTGCAGGCGGGTGGGCTGG + Intronic
1051404943 9:16727117-16727139 CGGCGGGCCGGCGGGCGGGCGGG + Intronic
1053011770 9:34637692-34637714 CTGCATCCCGGCGGGCGGCCTGG + Exonic
1057758351 9:97854018-97854040 CCACGGGCCGCGGGGCGGGCGGG + Exonic
1059379662 9:113913200-113913222 CCACCTCCCTGCGTGTGGGCAGG - Intronic
1061610057 9:131740081-131740103 CCGAGGCCCGGCGGGCGGGCGGG - Intergenic
1061808506 9:133149275-133149297 CCTCGCACCTGCGGGCGGGCTGG - Intronic
1062272132 9:135714450-135714472 CCGCGACCCACCGGGCGGGCGGG - Intronic
1062424361 9:136499172-136499194 CCACGGCCAGGCGGGCAGCCAGG + Exonic
1062554391 9:137107417-137107439 CCACGTCCCGACGGCCCGGCTGG - Exonic
1062574539 9:137200169-137200191 CCCGGGCGCGGCGGGCGGGCTGG + Exonic
1189534694 X:41923803-41923825 CCGCGTCACGGCGAACGGGCGGG + Intergenic
1192561734 X:72131844-72131866 GCGCGACCGGGCGGGCGGGCGGG + Intronic
1195108496 X:101623199-101623221 CCACTGCCCTGAGGGCGGGCCGG + Exonic
1200238667 X:154482311-154482333 CCACGGCCCGGCTGGAGGACTGG - Intergenic