ID: 1024473573

View in Genome Browser
Species Human (GRCh38)
Location 7:49788151-49788173
Sequence ACCACAGCCCGAGCCAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024473573_1024473577 -1 Left 1024473573 7:49788151-49788173 CCACTCCTGGCTCGGGCTGTGGT 0: 1
1: 0
2: 3
3: 24
4: 231
Right 1024473577 7:49788173-49788195 TCCAGCACTTCCTGGGTAATTGG 0: 1
1: 0
2: 3
3: 15
4: 163
1024473573_1024473580 17 Left 1024473573 7:49788151-49788173 CCACTCCTGGCTCGGGCTGTGGT 0: 1
1: 0
2: 3
3: 24
4: 231
Right 1024473580 7:49788191-49788213 ATTGGCAGCTGATGTGTTGAAGG 0: 1
1: 0
2: 3
3: 9
4: 201
1024473573_1024473576 -8 Left 1024473573 7:49788151-49788173 CCACTCCTGGCTCGGGCTGTGGT 0: 1
1: 0
2: 3
3: 24
4: 231
Right 1024473576 7:49788166-49788188 GCTGTGGTCCAGCACTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 196
1024473573_1024473575 -9 Left 1024473573 7:49788151-49788173 CCACTCCTGGCTCGGGCTGTGGT 0: 1
1: 0
2: 3
3: 24
4: 231
Right 1024473575 7:49788165-49788187 GGCTGTGGTCCAGCACTTCCTGG 0: 1
1: 0
2: 2
3: 14
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024473573 Original CRISPR ACCACAGCCCGAGCCAGGAG TGG (reversed) Intronic
900426950 1:2585332-2585354 TGCACAGCCCGAGACAGTAGAGG + Intergenic
900726210 1:4218007-4218029 GCCACAGGCGGAACCAGGAGAGG - Intergenic
901059892 1:6467182-6467204 AACCCAGCCCAAGCCAGGGGTGG + Exonic
903260362 1:22128568-22128590 ATCCCAGCCCCAGCCAGGGGTGG + Intronic
903974083 1:27137931-27137953 ACCACTGGCCAAGCCAGCAGTGG - Intronic
904043621 1:27598106-27598128 CCCACCCCCTGAGCCAGGAGAGG - Intronic
904410194 1:30320461-30320483 AGAACACCCAGAGCCAGGAGTGG - Intergenic
904475369 1:30761677-30761699 CCCCCAGCCCTAGCCAGCAGAGG + Intergenic
904585712 1:31579524-31579546 AGCCCAGCCCAAGCCAGGAGGGG - Intronic
906606291 1:47174748-47174770 CCCCCAGCCCAAGCCAGGACAGG + Intergenic
908682917 1:66682331-66682353 ACCAGGGCCCGAGCCAGGTCCGG - Exonic
910655271 1:89611847-89611869 ACCACTGTCTGAGCTAGGAGAGG + Intergenic
914849625 1:151304633-151304655 AACACAGCCAGGGCCAGGCGCGG - Intronic
915002658 1:152607704-152607726 AACTAAGCCTGAGCCAGGAGAGG - Intergenic
915996929 1:160572955-160572977 GCCCCAGCCCAATCCAGGAGGGG - Intronic
916738990 1:167631776-167631798 AACACAACCAGGGCCAGGAGTGG - Intronic
920561982 1:206945403-206945425 ACAGCAGCCCAAGCCAGCAGTGG - Intronic
922730435 1:227946532-227946554 CCCACAGTTGGAGCCAGGAGAGG + Intronic
924450725 1:244176494-244176516 ACTACAGCACCAGCTAGGAGAGG - Intergenic
1062855389 10:777467-777489 ATCACAGCCCACGCCAGGGGAGG - Intergenic
1063503700 10:6578332-6578354 ACCACAGCACAAGACAGTAGCGG + Intronic
1067344603 10:45428201-45428223 ACCCCAGTCAGAGCCAGGACAGG - Intronic
1070157156 10:73842352-73842374 AGCCCAGCTCCAGCCAGGAGGGG + Intronic
1070564574 10:77593939-77593961 AGCACAGTCCTCGCCAGGAGGGG + Intronic
1070677270 10:78420741-78420763 ACCAGAGCCTGAGACAAGAGGGG + Intergenic
1070920570 10:80183043-80183065 TCCCCAGCCCATGCCAGGAGGGG - Intronic
1071709989 10:88040711-88040733 AACATAGCCCCAGCCAGGTGCGG + Intergenic
1074249087 10:111725703-111725725 ACCACAGCACGTTCCTGGAGTGG + Intergenic
1074337968 10:112597506-112597528 AACACAGCCCAGGCCAGGTGTGG - Intronic
1075442407 10:122490623-122490645 ACCAGAGGCTGAGCCAGGTGGGG + Intronic
1076685937 10:132198531-132198553 AGCACAGCCCCAGGCAGCAGTGG - Intronic
1077062955 11:625755-625777 AGCCCAGCCCCAGCCATGAGAGG - Intronic
1077360826 11:2139520-2139542 CCCGCAACCCGAGCCAAGAGCGG + Intronic
1078699705 11:13668853-13668875 ACCACTTCCCGAGCCAGGCGAGG - Intronic
1079456400 11:20640074-20640096 ACCAAAGACCTTGCCAGGAGAGG + Intronic
1083294224 11:61706615-61706637 ACAACATCCAGAGACAGGAGTGG + Intronic
1084053497 11:66616430-66616452 GCCACAGCCCGTGGCGGGAGAGG - Intergenic
1084241881 11:67826884-67826906 ACCACAGCAAGAGCATGGAGAGG + Intergenic
1084732453 11:71082174-71082196 TCCACAGTGCCAGCCAGGAGTGG - Intronic
1085272828 11:75280465-75280487 AGCACAGCCCGACCCAGGAGGGG + Intronic
1085318846 11:75562303-75562325 AGCCCAGCCCGACCCAGGTGAGG + Intronic
1088279393 11:108121409-108121431 ACCGCAGCCTGGGCCAGGAAAGG - Intergenic
1089311926 11:117563953-117563975 ATCAAAGCCTGAGCAAGGAGAGG + Intronic
1089651937 11:119920278-119920300 AGAACAGCCCGTGGCAGGAGGGG - Intergenic
1090393814 11:126406328-126406350 CCCTCAGCCAGGGCCAGGAGAGG + Intronic
1090859855 11:130643202-130643224 ACAACAGCCTGAGCCGGCAGAGG - Intergenic
1091779604 12:3205509-3205531 ACCTCAGCCCGAGCCCACAGAGG - Intronic
1092524193 12:9299494-9299516 ACCACAGTGAGAGCCAAGAGCGG - Intergenic
1092542603 12:9429456-9429478 GCCACAGCCCGGGCCAGAGGTGG + Intergenic
1092543073 12:9432318-9432340 ACCACAGTGAGAGCCAAGAGCGG + Intergenic
1092720510 12:11436027-11436049 ACCACACCCCGAAACAGGAGAGG + Intronic
1093272013 12:17075157-17075179 AACACAGCACCAGCCAGGTGTGG - Intergenic
1093528498 12:20133518-20133540 TCCTTAGCCTGAGCCAGGAGAGG + Intergenic
1094510412 12:31092978-31093000 GCCACAGCCCGGGCCAGAGGTGG - Intronic
1096013746 12:48247109-48247131 CCCTCAGCCAGAGCCAGGAAGGG + Intergenic
1096094185 12:48923871-48923893 GTCACAGCCAGAGGCAGGAGAGG + Intronic
1096542972 12:52318521-52318543 CCCACAGCTCAGGCCAGGAGGGG - Intronic
1096680721 12:53253460-53253482 GCCCCTGCCAGAGCCAGGAGAGG - Exonic
1096789141 12:54034244-54034266 ACCCCACCCCAAGCCAGGAAGGG - Intronic
1096838582 12:54367604-54367626 ACCACTGCCCTAACCAGGACTGG - Intergenic
1096846954 12:54412589-54412611 AACACAGACCCAGCCAGGAAGGG - Intronic
1098891943 12:76018128-76018150 ACCACAGGGCAGGCCAGGAGCGG - Intergenic
1099447152 12:82766028-82766050 AGCAGAGCCCGGGCCAGGACTGG - Intronic
1100718045 12:97326229-97326251 GCCACACCCAGAGCCAGAAGAGG - Intergenic
1103057692 12:117834626-117834648 ACCGCAGCCCGAGCAAGGTCAGG - Intronic
1103474826 12:121210487-121210509 ACCACAGCCTGGGCCAGGCGCGG + Intronic
1106242346 13:27921665-27921687 ACCCCAGGCGCAGCCAGGAGGGG + Intronic
1106460530 13:29964013-29964035 GCCACAGCCCCAGGCAGGTGAGG + Intergenic
1107464990 13:40641272-40641294 ACCACACCCTGAGCCACGACAGG + Intronic
1107756479 13:43628980-43629002 ATCACAGCCCCAGCAAGAAGGGG + Intronic
1107969946 13:45631678-45631700 GCCACTGCCCCAGCCAGAAGTGG - Intergenic
1111255347 13:85660694-85660716 ACAACAGCCAGAACCAGAAGAGG + Intergenic
1111582351 13:90239099-90239121 ACCATAGCACTATCCAGGAGAGG + Intergenic
1112290922 13:98143441-98143463 CCCGGAGCCCGAGCCGGGAGAGG + Intronic
1113248911 13:108429374-108429396 ACCATATCCCAAGCCAGCAGGGG + Intergenic
1113429819 13:110240388-110240410 AGCAGAGCCCGGGCCAGGACTGG - Intronic
1113882738 13:113636768-113636790 GACACATCCCGAGCCGGGAGGGG - Intronic
1117353545 14:54902795-54902817 ATCACACTCCGAGCCGGGAGCGG + Exonic
1117504440 14:56388446-56388468 ACCACATGCCTAGCCAGTAGTGG - Intergenic
1118363501 14:65075358-65075380 ACCACAGCCAGAACCAGGGCTGG + Intronic
1119478914 14:74947777-74947799 TCCAGAGCCCTAGCCAGGGGCGG - Intronic
1122897690 14:104768651-104768673 ACCGCGCCCTGAGCCAGGAGAGG - Intergenic
1123757405 15:23407660-23407682 ACCACATCTCCGGCCAGGAGTGG - Intergenic
1124183479 15:27500335-27500357 CACACAGCCCGAGGCAGAAGGGG + Intronic
1124632399 15:31345144-31345166 ATCCCAGGCAGAGCCAGGAGAGG + Intronic
1126671720 15:51121367-51121389 ACCTCAGCTTGAGCCAGGAGAGG - Intergenic
1126764944 15:52002424-52002446 ACCACAGTCAGAGCCAGGAGAGG - Intronic
1127812036 15:62573120-62573142 ACCACATCCTGAGCCAGGTGTGG + Intronic
1129150436 15:73684665-73684687 CCCACAGCCCAGGGCAGGAGGGG - Intronic
1129160027 15:73742165-73742187 ACCATTGCCCAGGCCAGGAGTGG + Intronic
1130233297 15:82113009-82113031 ACCACGGCCCAAGGCAGAAGTGG - Intergenic
1131108178 15:89748442-89748464 ACTCCGGCCCGGGCCAGGAGGGG - Intergenic
1133675329 16:8065654-8065676 ACCACAGCCCAGGCCAGGCGCGG + Intergenic
1134094593 16:11411182-11411204 TGCCCAGCCCGAGGCAGGAGGGG - Intronic
1135159748 16:20083185-20083207 ATGACAGCCTGTGCCAGGAGCGG - Intergenic
1135764322 16:25164452-25164474 AGCACAGCCCCAGTCAGGACAGG - Intronic
1136055843 16:27688972-27688994 ACTACAGCCAGGGCCAGGAGTGG + Intronic
1136514351 16:30759006-30759028 ACCAGAGCCAGAGCCAAGTGAGG - Exonic
1138251649 16:55506277-55506299 GCCACAGACCCAGCCAGAAGCGG + Exonic
1138683334 16:58703356-58703378 ACCAAAATCCAAGCCAGGAGTGG - Intergenic
1139711870 16:68782166-68782188 ACCACACCCAAAGGCAGGAGTGG + Intronic
1139958460 16:70704488-70704510 CACACAGCCCCAGGCAGGAGGGG - Intronic
1140350465 16:74257584-74257606 ACAACAGCATGAGCAAGGAGCGG + Intergenic
1141798414 16:86290185-86290207 AGCACAGCCCTGGCCATGAGGGG - Intergenic
1142266519 16:89066463-89066485 ACCACAGACCGAGGCAGTGGAGG - Intergenic
1143628740 17:8125333-8125355 ATCATAGCCCGAGCCGGGAGAGG + Intergenic
1144835328 17:18153903-18153925 AGCACAGCCGTAGCCAGGGGAGG + Intronic
1145272076 17:21410117-21410139 GACACTGCCAGAGCCAGGAGTGG - Intronic
1145310284 17:21697579-21697601 GACACTGCCAGAGCCAGGAGTGG - Intronic
1145987186 17:29054929-29054951 CCCACAGCACCTGCCAGGAGTGG + Intronic
1146515673 17:33487309-33487331 AGGAAAGCCAGAGCCAGGAGGGG + Intronic
1147325066 17:39666154-39666176 TCCACAGTCCTAGCCAGGAAGGG - Exonic
1147581216 17:41628181-41628203 CCCACAGCCCCATACAGGAGGGG - Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1151310774 17:73291291-73291313 CCCACTGCCCCAGCGAGGAGGGG + Intronic
1151534328 17:74730153-74730175 GCCACAGCCCGAGAGAGGAGTGG - Intronic
1151850553 17:76687228-76687250 AGCACAGCCTGAAGCAGGAGGGG - Intronic
1152148668 17:78585065-78585087 ACTATAGCACGAGCCAGGATTGG - Intergenic
1152554923 17:81048406-81048428 ACCCCAGCACGGCCCAGGAGTGG + Intronic
1152785960 17:82248264-82248286 ACAAAAGCCAGAGCGAGGAGAGG + Intronic
1154175738 18:12086611-12086633 GCCACAGCCTGAGCCAGGGAAGG - Intergenic
1156074330 18:33255168-33255190 ACGAAAGCCCTAGCCAGGATGGG + Intronic
1156482737 18:37446319-37446341 GACACAGCCCCAGCCTGGAGGGG + Intronic
1160088803 18:75806627-75806649 AAGACAGACAGAGCCAGGAGGGG + Intergenic
1160583495 18:79900606-79900628 GCCGCAGCCCGAAGCAGGAGGGG + Intergenic
1161296293 19:3522244-3522266 TGCACAGCCCGAGGCAGGAAGGG - Intronic
1161938979 19:7390749-7390771 ATCACAGACCAAGCCAGGTGTGG + Intronic
1162534322 19:11253974-11253996 GCCACAGGCCCAGCCGGGAGGGG - Intronic
1163004382 19:14388530-14388552 TCCACAGCCAGAGCCTGGGGAGG + Intronic
1163063081 19:14774204-14774226 TCCACAGCCAGAGCCTGGGGAGG - Intronic
1165155381 19:33783943-33783965 ACCACAGCTCCACCCAGGAGTGG + Intergenic
1165462832 19:35954133-35954155 ACCAGAGACAGAGGCAGGAGAGG - Intergenic
1165937421 19:39397807-39397829 ACCGCAGCGGGAGCCAGCAGGGG + Exonic
1166164452 19:40977524-40977546 GCCACAGCCTGAGCCATGAAAGG - Intergenic
1166345383 19:42162196-42162218 ACCACAGCCCCAGGTAGCAGAGG - Intronic
1166364529 19:42271936-42271958 ACCACAGTCCGGGCCCGAAGAGG + Intronic
1167381924 19:49143146-49143168 ACCACAGGCCAAGTTAGGAGTGG - Intronic
1202706596 1_KI270713v1_random:29093-29115 ACCCCAGCCTGAGCCAAGTGGGG + Intergenic
926055294 2:9770814-9770836 ACCACAGCCCAGGCCAGGGCCGG - Intergenic
927514029 2:23661540-23661562 GCCACTGCCCATGCCAGGAGGGG - Intronic
927695749 2:25238728-25238750 GCCACAGCCTGTTCCAGGAGAGG - Intronic
927856617 2:26531584-26531606 TCCACAGGCCGAGGCAGAAGAGG - Intronic
935029719 2:99310456-99310478 ACCACCGCTCTGGCCAGGAGTGG - Intronic
935047699 2:99497208-99497230 ACCAGAGACCGTCCCAGGAGGGG - Intergenic
939962471 2:148577595-148577617 ACAATAGCCCCAGCCGGGAGTGG - Intergenic
946038758 2:216765972-216765994 ACCCCAGAGCCAGCCAGGAGTGG - Intergenic
948796077 2:240402641-240402663 ACCAGTGCCCGAGTCAGCAGAGG + Intergenic
1170672075 20:18443745-18443767 GCCAGAGCCCGAGCAAGAAGTGG - Intronic
1170964226 20:21052258-21052280 ACCACACCCTGAGCCAGGCATGG - Intergenic
1171524288 20:25797204-25797226 GCCACAGCCCCACCCATGAGAGG + Intronic
1171552539 20:26058679-26058701 GCCACAGCCCCACCCATGAGAGG - Intergenic
1172680284 20:36708741-36708763 AGCACAGCCCAAGCCGGGCGCGG + Intronic
1173672609 20:44809377-44809399 ACCTCAGCCAGAGCGAGGGGTGG - Intronic
1174253398 20:49236072-49236094 ACAAGAGCCTGAGCCAGCAGAGG - Intronic
1175248457 20:57595263-57595285 ACCACAGGCCGAGCCCTGCGTGG - Intergenic
1175333510 20:58180071-58180093 CCCACCGCCACAGCCAGGAGAGG + Intergenic
1175387478 20:58606445-58606467 CCCACAGCCTGTGGCAGGAGGGG - Intergenic
1175935312 20:62511288-62511310 ACCACAACCTGACCCAGGAAGGG + Intergenic
1176285242 21:5015941-5015963 CCCACAGCCCAAGCCTGCAGGGG - Intergenic
1177184799 21:17781447-17781469 ACCACAGAAACAGCCAGGAGAGG - Intergenic
1177626770 21:23672314-23672336 ACAACATCCCGAGCTAGGAGGGG + Intergenic
1178257194 21:31065037-31065059 ACCACAGCCCCACCCAGGTGTGG + Intergenic
1178906193 21:36638889-36638911 ACCAGAGACTGAGCCTGGAGTGG + Intergenic
1179871939 21:44247534-44247556 CCCACAGCCCAAGCCTGCAGGGG + Intronic
1179956282 21:44740947-44740969 ACCCCAGCCCCAGCTGGGAGGGG - Intergenic
1180862020 22:19089007-19089029 CCCACATCCAGAGCCAGGATGGG + Intronic
1181273722 22:21675701-21675723 ACCACAGCCTCAGCCAGAGGGGG - Intronic
1181577063 22:23801947-23801969 CCTACAGCCTGAGCAAGGAGAGG - Intronic
1181728950 22:24830931-24830953 ATCACAGCCCTGTCCAGGAGGGG - Intronic
1182681216 22:32081393-32081415 ACCCCACCCCCACCCAGGAGCGG - Intronic
1182834734 22:33332812-33332834 GCCCCAGCCCCAGCCAGCAGAGG + Intronic
1183010208 22:34940086-34940108 AGCACATCCCCAGCCAGGCGCGG - Intergenic
1184466061 22:44669309-44669331 GCCACAGGCTGAGCCAGGACAGG - Intronic
1184805697 22:46793692-46793714 ACCACAGCCAGCGGCAGGGGCGG + Exonic
1185109376 22:48892584-48892606 ACCACAGCACGGGCAAGCAGGGG + Intergenic
1185336124 22:50271607-50271629 AACCCAGCCCGAGCGAGGAGAGG - Intergenic
950764233 3:15261454-15261476 GTCACAGCCCCAGCCAGGAGGGG - Intronic
952426367 3:33178726-33178748 ACTACAGACCGGGCCAGGCGCGG - Intronic
953365329 3:42339769-42339791 ACCTCAGCATAAGCCAGGAGTGG - Intergenic
953637976 3:44678626-44678648 ACCACAGCCCACACCAGGGGTGG + Intergenic
953648026 3:44773416-44773438 ACCCCAGCCCCACCCAGAAGGGG + Intronic
954380449 3:50216287-50216309 AGCCCAGCCCGAGCAAGCAGAGG + Intronic
954430430 3:50467951-50467973 ACCACAGCCGGCCCCAGGGGCGG - Intronic
961518248 3:127451786-127451808 ACCACAGCAAGACCCAGAAGGGG - Intergenic
962370612 3:134818018-134818040 TCCACAAGCTGAGCCAGGAGTGG - Intronic
963087423 3:141451176-141451198 ACCACAGCCCGGGGCAAGGGTGG + Intergenic
966523197 3:180895008-180895030 ATCCCAGCCCCAGCAAGGAGAGG - Intronic
968450918 4:675554-675576 ACCCCAGAGCAAGCCAGGAGAGG - Intronic
968804326 4:2762744-2762766 AAGGCTGCCCGAGCCAGGAGCGG - Intergenic
969110119 4:4839280-4839302 GCCACAGTCTCAGCCAGGAGAGG + Intergenic
969305306 4:6322976-6322998 ACCGCAGACCGAGACAGGAAGGG + Exonic
969324916 4:6437446-6437468 ACTACAGCCAGAGCGGGGAGTGG + Intronic
973946648 4:55963453-55963475 ACCAAAGCTTGGGCCAGGAGTGG + Intronic
975328901 4:73091465-73091487 ACCACCAGCCCAGCCAGGAGGGG - Exonic
982215915 4:153082527-153082549 ACCACAGCAGGAGACAGAAGTGG + Intergenic
983225732 4:165084615-165084637 ACCACAGACATGGCCAGGAGTGG + Intronic
984211612 4:176856464-176856486 ACCATACCCCAAGCCAGAAGGGG - Intergenic
989520586 5:42396232-42396254 ACCAGAGCAGGTGCCAGGAGTGG - Intergenic
990426339 5:55693768-55693790 ATCACTGCCAGAGCCAGGCGTGG + Intronic
991974834 5:72175423-72175445 ACCACAGCTGGTGCCAGGATTGG + Intronic
1000314906 5:160080969-160080991 ACAACAGCCTTTGCCAGGAGAGG + Intronic
1002569507 5:180132175-180132197 GCTTCAGCCCGAGGCAGGAGGGG - Intronic
1002878801 6:1234379-1234401 ACCAGAGACAGAGCCTGGAGAGG - Intergenic
1003244806 6:4374740-4374762 CCCACAGGTAGAGCCAGGAGAGG - Intergenic
1003460060 6:6320754-6320776 TCCACAGCTGGAGCCAGTAGGGG + Exonic
1007369629 6:41417890-41417912 TCCACAGCCAGAGCCTGGACTGG - Intergenic
1010508519 6:76689001-76689023 ACTACAGCCCTACCCAGAAGTGG + Intergenic
1011294477 6:85811212-85811234 ACCCCAGACCCAGCCAGCAGAGG - Intergenic
1011684716 6:89815076-89815098 CTCACAGCCTGAGCCAGAAGAGG + Intronic
1012170837 6:96015682-96015704 CCCCCAGCCTGAGCCACGAGAGG + Intergenic
1013601748 6:111711709-111711731 ACCAGAGCCAGAGGCGGGAGAGG + Intronic
1015962963 6:138669551-138669573 ACCACATTCCTAGCCACGAGTGG + Intronic
1017891610 6:158644284-158644306 GCCCCAGCCCCAGCCTGGAGCGG - Intronic
1018443543 6:163834691-163834713 ACCAAAGCCCGTGCCAGGAGTGG + Intergenic
1019094383 6:169567076-169567098 GCAGCAGCCCGAGCCAGGTGGGG + Intronic
1019487131 7:1294487-1294509 TCCACAGCCAGAGCCAAGAGGGG - Intergenic
1019572058 7:1717559-1717581 ACCACATCCCCAGCCAGGCCTGG - Intronic
1019656641 7:2199623-2199645 ACCCCTGCCCGTGCCAGGCGGGG - Intronic
1020175063 7:5875596-5875618 ACCAGAGACCAGGCCAGGAGTGG - Intergenic
1020187567 7:5970639-5970661 ACCTCAGCCCGAGCCCGGCGAGG - Exonic
1020295350 7:6754131-6754153 ACCTCAGCCCGAGCCCGGCGAGG + Exonic
1021989074 7:26124770-26124792 ACAACAGCCCAAGCCAGGTAGGG + Intergenic
1023863886 7:44229719-44229741 GCCAGAGCCAGAGCCAGCAGAGG + Intronic
1024473573 7:49788151-49788173 ACCACAGCCCGAGCCAGGAGTGG - Intronic
1026901291 7:74038845-74038867 ACCAGGGCTGGAGCCAGGAGAGG + Intronic
1027269322 7:76511445-76511467 TCCCCACCCAGAGCCAGGAGTGG - Intronic
1027320033 7:77005340-77005362 TCCCCACCCAGAGCCAGGAGTGG - Intergenic
1029386896 7:100249137-100249159 ACCCCACCCCAGGCCAGGAGCGG - Intronic
1032250954 7:130256787-130256809 GCCCCAGCCCCAGCCAGGAAGGG - Intergenic
1033051598 7:138009228-138009250 ACCACTGCTGGGGCCAGGAGTGG - Intronic
1035100136 7:156389538-156389560 AGCACCGCCCTAGCCAGCAGTGG + Intergenic
1038319713 8:26514944-26514966 ACCACCGCCCGCCCCAGCAGGGG - Intronic
1039752668 8:40492591-40492613 ACCAACACCCGAGTCAGGAGTGG - Intergenic
1042183110 8:66111729-66111751 AACAAAGCCAGAGCCAGGTGAGG + Intergenic
1045614817 8:103897288-103897310 ACCACAGCCCTATTCAAGAGTGG - Intronic
1048493300 8:134914209-134914231 ACCACAGCAAGAGACTGGAGTGG - Intergenic
1049602489 8:143514332-143514354 ACCAGGGCCCGAGCCAGGATGGG - Intronic
1051115455 9:13688736-13688758 ACAACAGCCTGAGCCATGTGAGG - Intergenic
1051449271 9:17177863-17177885 ACCGCTGCCTGAGCCAGCAGTGG - Intronic
1051996240 9:23221008-23221030 ACCACAGCCCAAATCAGGACAGG + Intergenic
1052397027 9:27950619-27950641 ACCACAGCCAGACCCAGGAATGG + Exonic
1052834276 9:33238764-33238786 AGGACAGCCCCAGCCAGGTGCGG - Intronic
1052959948 9:34286858-34286880 ACCTCAGCCCGATTCAGGGGTGG + Intronic
1057200451 9:93137042-93137064 AGCACATCCCAAGCCAGAAGGGG - Intergenic
1057824905 9:98364889-98364911 TCCACTGCCCCAGCCAGGTGTGG - Intronic
1060527162 9:124327195-124327217 CCCACAGCCAGAGCCAGGACAGG + Intronic
1062269073 9:135700478-135700500 ACCTCAGCACGAGCCAGGCCAGG - Intergenic
1062338175 9:136081711-136081733 CCCAGGGCCCGAGCCAGGAGGGG - Intronic
1062452796 9:136622582-136622604 AGCACAGCCCAAGGCAGGTGAGG + Intergenic
1062570009 9:137180650-137180672 AGCACACCCCCAGCCAGGAGTGG + Intronic
1185470997 X:383078-383100 TCCAGATCCCGATCCAGGAGGGG - Intronic
1185506552 X:635508-635530 CCCACAGCCGGAGGGAGGAGGGG - Intronic
1187406289 X:19007229-19007251 ACATCAACCCGAGCCAGGTGGGG - Exonic
1191254800 X:58275069-58275091 ACCAAAGCCCGGGTCAGGTGCGG + Intergenic
1193151023 X:78124866-78124888 ACCACAGTCCAAGCCCTGAGGGG - Exonic
1194058468 X:89166089-89166111 ACCACCACCTGATCCAGGAGAGG - Intergenic
1196563035 X:117173512-117173534 GCCCCAGCCCGAGCTGGGAGGGG - Intergenic
1199169340 X:144717859-144717881 ACCCCAGTCCTGGCCAGGAGGGG - Intergenic
1200216055 X:154368733-154368755 GCCACAGGCCTAGCCAGGGGAGG + Intronic