ID: 1024478483

View in Genome Browser
Species Human (GRCh38)
Location 7:49839405-49839427
Sequence TTGGTTGTCCTCAAATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024478483 Original CRISPR TTGGTTGTCCTCAAATTTGA TGG (reversed) Intronic
904279726 1:29410377-29410399 TAGGTTTTCATCAAATTTGGAGG + Intergenic
908680392 1:66654417-66654439 TTAGTTGTCTTCAACCTTGAGGG + Intronic
909330135 1:74399872-74399894 TTGGTAGACATCAAATTTTATGG - Intronic
909892429 1:81024250-81024272 TTTGGTGTCCTCAAAGTTGGAGG - Intergenic
909934845 1:81539268-81539290 TTGGTTGTCATAATAATTGAAGG - Intronic
911013018 1:93301750-93301772 TTGCTTGTTTTCAAATGTGAGGG + Intergenic
911653377 1:100415117-100415139 CTGGTTGTAATCAAATTAGATGG + Intronic
916696125 1:167238379-167238401 TTGTTTGTTTTCAAATTTTATGG - Intronic
918492931 1:185101865-185101887 TTGGTGGTTTTCAAATTTCATGG - Exonic
918902892 1:190448071-190448093 TTTGTTTTACTTAAATTTGAAGG + Intronic
920385119 1:205565779-205565801 GTGGTTATTCTTAAATTTGAAGG - Intergenic
920830266 1:209458254-209458276 CTGATTGTGCTCCAATTTGAGGG - Intergenic
923515405 1:234694005-234694027 TTGGTTGTCCTCAGTATTGAAGG + Intergenic
1062871321 10:907644-907666 TTGGTTTTCCTCCCATTTCATGG + Intronic
1063465749 10:6243140-6243162 TTGGTTGTCTTGGAACTTGAAGG - Intergenic
1064547373 10:16464368-16464390 CTGGTTTTACTCAACTTTGAAGG + Intronic
1064865619 10:19876028-19876050 CTGATTGTCCTCAAATTTTGTGG - Intronic
1068207340 10:53872806-53872828 TTTGATATCCTCAAATTTTATGG - Intronic
1068802839 10:61161666-61161688 TTGCTTATCCTCAAATTTATTGG + Intergenic
1069053372 10:63817782-63817804 TAATTTGTACTCAAATTTGATGG + Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1071007802 10:80902705-80902727 GTGGTTGTCCTCAAATACGAAGG + Intergenic
1072255023 10:93613084-93613106 CAGGTTGTCCTCAAACTTGGAGG - Exonic
1078949272 11:16110910-16110932 TTTGTTGTACTCAGATTTGATGG + Intronic
1079024672 11:16937000-16937022 CTGGTAGTCCTCAAAGATGAGGG - Intronic
1079505627 11:21149258-21149280 TTGGATTTCCTAAAATCTGAAGG + Intronic
1083293301 11:61701624-61701646 TTGTTTGTTCTCACATTCGAGGG + Intronic
1087903508 11:103669417-103669439 TTGGATCTCCTCATGTTTGAAGG + Intergenic
1093124273 12:15309068-15309090 ATGGATGTCCTGAAATTTGTTGG - Intronic
1093151505 12:15626797-15626819 TTGGTGCTCTTCAAATTTAAAGG + Intronic
1093284975 12:17247743-17247765 TTTGTTGACTTCAAAGTTGAGGG - Intergenic
1093442449 12:19214636-19214658 TTTGTTGCCCTCAAATCTTAGGG - Intronic
1097208008 12:57340160-57340182 TTGGTTTTCCTTTCATTTGAGGG - Intronic
1097293187 12:57937134-57937156 TTGGTTGTCCTTAAATGGGTAGG - Intergenic
1099496022 12:83347485-83347507 TTGTTTGTCCTCAAGTGTGTTGG - Intergenic
1099685431 12:85881342-85881364 TTGGTTGTCTTCTAATTTGAGGG - Intronic
1103618467 12:122170830-122170852 TTAGTGGTTCTCAAACTTGAGGG + Intronic
1106051056 13:26189941-26189963 TTCATTTTCCACAAATTTGATGG + Intronic
1106081400 13:26503281-26503303 CCGGTTGTCCTCAAATATTAGGG + Intergenic
1106793934 13:33184964-33184986 TAGATTTTCCTCAAATTTGAAGG - Intronic
1106903310 13:34378319-34378341 TTTGTTGTTCTCAATTTTTAAGG - Intergenic
1108109468 13:47052672-47052694 TTGCTTCTCCACTAATTTGAAGG - Intergenic
1109206151 13:59485467-59485489 TTGGTTGTCATCCCATTTCAGGG - Intergenic
1111534291 13:89581736-89581758 TTGGTTGTCCCGAAATATGTAGG + Intergenic
1112840666 13:103573521-103573543 TAGCTTGTACTCACATTTGACGG - Intergenic
1119367762 14:74109479-74109501 TTGGTTGGCCGTAAATGTGAAGG + Intronic
1123392221 15:19888428-19888450 TTTGTTTTCCACAAATTTGGGGG + Intergenic
1127041505 15:54982074-54982096 TGGGTTGTTCTCAAACTTGAAGG + Intergenic
1128696035 15:69763560-69763582 TTAGTTGTCCCTAAGTTTGATGG + Intergenic
1131756273 15:95565933-95565955 TTTGTTCTCCCCAAATTTGGTGG - Intergenic
1141118791 16:81334697-81334719 TGGTTTGTCCTCAAATGAGAAGG - Intronic
1141254806 16:82391015-82391037 TTGGTTGTCAGCAAATCTGCTGG + Intergenic
1143576815 17:7798606-7798628 TTGGGTGTCCACAAAAATGAAGG - Exonic
1144111885 17:12043523-12043545 TTGGATGACTTCAAATTTGGGGG + Intronic
1150618502 17:66790562-66790584 TTTGTTGTCTTAAAATATGAAGG + Intronic
1150909410 17:69372163-69372185 TTGATTGTCCCCAGATTTGGGGG - Intergenic
1151955868 17:77379921-77379943 TTGGTTTTTCCCAAATTTGGAGG + Intronic
1155424475 18:25691838-25691860 TTACTTCTCCTCAACTTTGAGGG - Intergenic
1156187111 18:34676234-34676256 TTTTGTGTCCTCCAATTTGAGGG + Intronic
1156378232 18:36533469-36533491 GTGCTTGTCCTCAAAGTGGATGG + Intronic
1159910552 18:74141694-74141716 TAGGTTGTGCTCAGAGTTGAGGG - Intronic
1160199304 18:76782974-76782996 TGGCTTGTCCTCAGATTTGGCGG - Intergenic
1162852790 19:13444108-13444130 TTGGTTGTCATGATATTTGCTGG - Intronic
1166970153 19:46561212-46561234 TTGGTTGTGCTTGAATTTTATGG + Intronic
1167393585 19:49212427-49212449 TTGGATCTCCTCCAATTTGGAGG - Intergenic
925715727 2:6782751-6782773 GTGGTTGTTGTGAAATTTGATGG - Intergenic
930290546 2:49487887-49487909 TTGTTTGTCCTTTAATATGAGGG - Intergenic
930625003 2:53687089-53687111 TGGGTTGTACTCACATTTGCTGG - Intronic
933533030 2:83534835-83534857 TAGGATGTCCTCAGATTTGAGGG - Intergenic
934991680 2:98926124-98926146 CTGGTTTTCTTCAATTTTGAGGG - Intronic
935676319 2:105597671-105597693 TTGTTAGTCCTCAATTTGGAGGG - Intergenic
938817661 2:134919912-134919934 TTTACTGTCCGCAAATTTGAGGG + Intronic
942377201 2:175349802-175349824 TTTACTGTCCTGAAATTTGATGG - Intergenic
944817044 2:203388101-203388123 TTCCTTTTCTTCAAATTTGATGG + Intronic
946117208 2:217473538-217473560 ATGGTTGACCTCAAATTCTAAGG + Intronic
947025178 2:225730088-225730110 TTGGTTGTGCTGAGATTTGTGGG + Intergenic
1169637855 20:7714539-7714561 TTTCTTTTCCTCAAATTTGTTGG + Intergenic
1170317752 20:15061165-15061187 AGGGTTGTCTTCAAAGTTGATGG - Intronic
1171723972 20:28597862-28597884 TTGGGTGTCATAAAATTAGATGG - Intergenic
1171859385 20:30382086-30382108 TTGGGTGTCATAAAATTAGATGG + Intronic
1173221382 20:41135787-41135809 GTGGGTGTCCTCAATTTTGGCGG + Intergenic
1175004554 20:55668184-55668206 TTGGTTGTCCTCGCAATTGCCGG + Intergenic
1177561550 21:22760714-22760736 TTTGTTGTCCTCATATTGAAAGG - Intergenic
1180297525 22:10956544-10956566 TTGGGTGTCATAAAATTAGATGG - Intergenic
1180951035 22:19720728-19720750 TTGTCTGGCCTCAAATCTGATGG + Intronic
1182979213 22:34652580-34652602 TTGGTTGTCCCCTACTTTCAAGG - Intergenic
949446539 3:4140769-4140791 TAGGTTATCCTCAAAGTAGAGGG + Intronic
950673009 3:14538411-14538433 CTGGTTGACCTTAAGTTTGAAGG + Intronic
951603252 3:24400278-24400300 TTGGATGTCCTTCAATGTGAGGG + Intronic
956831220 3:73050501-73050523 TTGGTTTTCCACCAGTTTGAGGG + Intronic
958255802 3:91323685-91323707 CTGGTTATCCTCAATTTTGGGGG - Intergenic
960336974 3:116429404-116429426 TTGGTTGACCTCATATTTTGTGG + Intronic
960567316 3:119147364-119147386 TTGGCTATCCTCAAATTTGCAGG - Exonic
966060836 3:175752977-175752999 TAGTTTGTCCTAAATTTTGATGG - Intronic
966118803 3:176498811-176498833 TGGGTTGTCCTGAAATCTGATGG - Intergenic
968248770 3:197185015-197185037 TTTGTGGTTCTCAAACTTGAAGG - Intronic
970898348 4:21129376-21129398 TTGGTTAACCTCACATTTCACGG + Intronic
973297464 4:48541278-48541300 TGTCTTGTCCTCAAACTTGATGG + Intronic
976112369 4:81689711-81689733 TGGCTTGTCCTGAAATTTGTAGG - Intronic
979828591 4:125271548-125271570 TTGGTTTAGCTCAAATTTGAAGG - Intergenic
981261736 4:142728976-142728998 TTGGTAGTCCTCAAACTTTTTGG + Intronic
986466328 5:8028592-8028614 TGGTTTGTCCTAAAATTTCAGGG + Intergenic
987956070 5:24741927-24741949 TTCGTTTTCCTCAAATTTTGGGG + Intergenic
988340317 5:29962008-29962030 TTGTTTTTCCTCACATCTGAAGG - Intergenic
990972302 5:61522008-61522030 TTGGTTGTCCCAAAACTTGGAGG - Intronic
991164001 5:63540262-63540284 TTGGTTGTCCCCAAACTTTTTGG - Intergenic
994643360 5:102437825-102437847 TTGGTTATCCTCAAAGTTACTGG + Intronic
994871447 5:105354808-105354830 TTGTTTGTCTTCAAATTTTAAGG + Intergenic
995408757 5:111831464-111831486 CTGGTTGTCAACATATTTGATGG + Intronic
996744388 5:126833834-126833856 ATGCTTGTCCACTAATTTGAAGG + Intronic
1000795934 5:165664477-165664499 TTGGTGCTCCTTTAATTTGATGG + Intergenic
1007536026 6:42589700-42589722 TTGTTTGTACTCATTTTTGAAGG + Intronic
1008999542 6:57697481-57697503 CTGGTTATCCTCAATTTTGGGGG + Intergenic
1009188025 6:60596903-60596925 CTGGTTATCCTCAATTTTGGGGG + Intergenic
1009242320 6:61197765-61197787 TTAGTTCTCATGAAATTTGACGG + Intergenic
1011543489 6:88458871-88458893 GTGGTAGTCATCAAATTGGAGGG + Intergenic
1012393319 6:98768088-98768110 TTGCTTATCCTCAAATTTATTGG - Intergenic
1015324423 6:131908338-131908360 TTGCTTTTCCTCATATTTGAGGG + Intergenic
1020993336 7:15230317-15230339 TTGGTTGTCTGCAAAATTTAAGG + Intronic
1021109994 7:16682742-16682764 TTGGTTGACCTAATATTTAATGG + Intronic
1024478483 7:49839405-49839427 TTGGTTGTCCTCAAATTTGATGG - Intronic
1027364842 7:77446743-77446765 ATCGTTCTCATCAAATTTGAAGG + Intergenic
1028079678 7:86559531-86559553 TTGATGGTGCTTAAATTTGAAGG - Intergenic
1028422460 7:90648896-90648918 TTGCTAGTTCTCAAATATGAGGG + Intronic
1028563569 7:92203314-92203336 CTGGTTGTTCCCACATTTGACGG + Intronic
1028669621 7:93386612-93386634 TTAGATCTCCTCAAATTAGAAGG + Intergenic
1028716116 7:93971412-93971434 TAAATTGTCCTCAAATTTTAAGG - Intronic
1031368897 7:120939336-120939358 TATGTTGTCCTCAAGTGTGAAGG - Intergenic
1033917086 7:146339356-146339378 TTTGGTTTCATCAAATTTGAAGG - Intronic
1036926437 8:12910630-12910652 TTGGTTCTCGTGAAATTTGATGG + Intergenic
1037502415 8:19498541-19498563 TGGGTTGTACACAAATTGGAAGG - Intronic
1038266337 8:26042189-26042211 TTGGATTTCCTCAAGTTGGAAGG + Exonic
1042382009 8:68127482-68127504 GGCGTTGTCCTCAAATTTCAAGG - Intronic
1042482957 8:69324259-69324281 CTGGTTTTCCTCTAGTTTGAGGG - Intergenic
1042537693 8:69875385-69875407 TTGGTTCTCATGAAATCTGATGG - Intergenic
1043358357 8:79440431-79440453 GTGGTTGACCTCCAATCTGACGG + Intergenic
1044972045 8:97629230-97629252 TTTGTTGTTCTGAAATTTTATGG - Intergenic
1047469380 8:125153776-125153798 TTGGCATTCATCAAATTTGATGG + Intronic
1047649317 8:126902372-126902394 TTGGTTGTGGTCAAAGCTGATGG + Intergenic
1050052409 9:1616897-1616919 CTGCTTTTCCTCAAGTTTGAGGG + Intergenic
1050514981 9:6434312-6434334 GTGGTTGTACTCTAATTTAAAGG + Intronic
1051404652 9:16722870-16722892 TGGTTTGTCCTAAACTTTGAAGG - Intronic
1052497100 9:29240842-29240864 TTGATTGTCCCCAGATTTGTGGG + Intergenic
1053725628 9:40997193-40997215 TTGGGTGTCATAAAATTAGATGG + Intergenic
1054340310 9:63854682-63854704 TTGGGTGTCATAAAATTAGAAGG - Intergenic
1055555769 9:77471830-77471852 TTGTTTGTCCTCAAATATAAGGG + Intronic
1056033190 9:82574903-82574925 TTTCTTGTCTTCAAATTGGATGG - Intergenic
1056374591 9:85994525-85994547 TTGGCTGCCCTTAAATTGGAAGG - Intronic
1057927353 9:99165354-99165376 TTGGTTTTCCTCAAATATTTGGG + Intergenic
1059808737 9:117832545-117832567 TTATTTGTCCTCTCATTTGATGG - Intergenic
1187078894 X:15965322-15965344 TATGCTGTCCCCAAATTTGAAGG - Intergenic
1189504408 X:41596490-41596512 TTTGCTTTCCTGAAATTTGAAGG + Intronic
1192127050 X:68511096-68511118 TTGGTTGTAATAAAATTTGACGG + Intronic
1194166513 X:90522525-90522547 TTGGTATTCCTCATATTTGGTGG + Intergenic
1195234211 X:102880836-102880858 TTGGAAGTCCCCAAATTTGCAGG + Intergenic
1196562080 X:117161637-117161659 TTGTATGTTCTCAAAATTGATGG + Intergenic
1199290470 X:146099587-146099609 TTGCTTGTCCTCTGATTTTATGG - Intergenic
1200512782 Y:4100306-4100328 TTGGTATTCCTCATATTTGGTGG + Intergenic
1201583727 Y:15537666-15537688 TTGGTTTTCCTCAAAATCTAAGG - Intergenic