ID: 1024479372

View in Genome Browser
Species Human (GRCh38)
Location 7:49848279-49848301
Sequence CCGTGGGAGGCTCTGAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024479372_1024479382 10 Left 1024479372 7:49848279-49848301 CCTCCACTCAGAGCCTCCCACGG 0: 1
1: 0
2: 2
3: 21
4: 304
Right 1024479382 7:49848312-49848334 CCAGGATCTTCTCTCTCCTGTGG No data
1024479372_1024479383 11 Left 1024479372 7:49848279-49848301 CCTCCACTCAGAGCCTCCCACGG 0: 1
1: 0
2: 2
3: 21
4: 304
Right 1024479383 7:49848313-49848335 CAGGATCTTCTCTCTCCTGTGGG No data
1024479372_1024479384 12 Left 1024479372 7:49848279-49848301 CCTCCACTCAGAGCCTCCCACGG 0: 1
1: 0
2: 2
3: 21
4: 304
Right 1024479384 7:49848314-49848336 AGGATCTTCTCTCTCCTGTGGGG 0: 1
1: 0
2: 1
3: 21
4: 217
1024479372_1024479378 -8 Left 1024479372 7:49848279-49848301 CCTCCACTCAGAGCCTCCCACGG 0: 1
1: 0
2: 2
3: 21
4: 304
Right 1024479378 7:49848294-49848316 TCCCACGGCAGGGTCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024479372 Original CRISPR CCGTGGGAGGCTCTGAGTGG AGG (reversed) Intronic
900089434 1:913409-913431 CCATTGGAGGCTCTGGGTGCAGG + Intergenic
900108741 1:996933-996955 CCGAGGGGGGCTCTGAGAAGGGG + Intergenic
900250571 1:1666642-1666664 CTGTGGGAGGCTAGGCGTGGGGG + Intronic
900250583 1:1666686-1666708 CTGTGGGAGGCTGGGTGTGGGGG + Intronic
900250595 1:1666730-1666752 CTGTGGGAGGCTGGGCGTGGGGG + Intronic
900285202 1:1895728-1895750 CCTTGGGGGCCTCTGAGAGGAGG + Intergenic
900465894 1:2825262-2825284 CCATGGGTGTCTCTGACTGGGGG + Intergenic
900478356 1:2886763-2886785 CGCTGGGAGGCTGGGAGTGGGGG - Intergenic
900526977 1:3134204-3134226 CTGTGGGAGCCTCTGTGTAGAGG - Intronic
900562758 1:3315795-3315817 CTGTGGGAGTCTCCGATTGGTGG - Intronic
900634692 1:3657228-3657250 CCCTCGGAGGCTCTGAGAGGGGG + Intronic
900795957 1:4708562-4708584 CCTTGGGCGGCTCTGAGATGAGG - Intronic
900820214 1:4880783-4880805 CCCTGGGAGGTGCTGAGTGATGG + Intergenic
900911231 1:5598377-5598399 CCGTGGGAGGCTCTGCACTGAGG - Intergenic
901216392 1:7557852-7557874 CTCTGGGAGCATCTGAGTGGAGG + Intronic
901528149 1:9836858-9836880 CCGGGGGAGGCTCAGAGGAGGGG - Intergenic
903035999 1:20492984-20493006 CCGTAGGAGGCTCTGGGCCGTGG - Intergenic
903833490 1:26188653-26188675 CCGTGGGCTGCGCTGTGTGGGGG - Exonic
904001004 1:27338741-27338763 CACAGGGTGGCTCTGAGTGGGGG - Intergenic
904212468 1:28894990-28895012 GTGTGGGAGGAGCTGAGTGGAGG + Intronic
904402387 1:30265381-30265403 CCGTGGCAGGCCCTGAGGAGTGG - Intergenic
905215333 1:36402318-36402340 ACGTGGGAGGCTGTGGCTGGAGG + Intergenic
907315445 1:53567970-53567992 CCAAGGGGGGCTCTGTGTGGGGG - Intronic
907882175 1:58560869-58560891 ACGGGGGAGGCTGTGTGTGGAGG + Intergenic
908396839 1:63733025-63733047 CCATGGGAAGCTCAGGGTGGAGG + Intergenic
909293310 1:73912221-73912243 CTGTGGGGGACTCTGTGTGGTGG + Intergenic
912644800 1:111382649-111382671 CCTTGGGAAGCTCTGGTTGGAGG - Intergenic
913316386 1:117557468-117557490 TCTTGTGAGGCCCTGAGTGGAGG - Intergenic
913380510 1:118205090-118205112 ACATTGGAGGCTGTGAGTGGTGG + Intergenic
914758486 1:150579832-150579854 TCTTCGGAGGCTCTGAGTGCCGG + Intergenic
915291629 1:154888087-154888109 ACAAGGAAGGCTCTGAGTGGTGG - Intergenic
921161898 1:212478848-212478870 CCGTGGGATGCTCAGGCTGGGGG - Intergenic
921506097 1:215972170-215972192 CAGTGGGAGGCACTGTGAGGAGG + Intronic
922808258 1:228401657-228401679 GTCTGGGAGGCTCTGGGTGGTGG - Intronic
923155535 1:231275463-231275485 CTGTGTGAGGCTCGGAGTAGTGG + Exonic
1064244967 10:13660935-13660957 CTGTGGGAGGGTCTGAGTTCTGG + Intronic
1065662397 10:28019579-28019601 ACTTGGGAGGCTCTGACAGGAGG - Intergenic
1067779444 10:49188805-49188827 CCATGGGAGCCTCTGAGTCTAGG + Intergenic
1069590116 10:69636193-69636215 CCCTGAAAGGCTCTGAGAGGCGG - Intergenic
1069854870 10:71434579-71434601 GCTGGGGAGGCTCTGAGAGGTGG - Intronic
1071546574 10:86534564-86534586 CCGTGGGATGCTGTGAAGGGAGG - Intergenic
1072746005 10:97939605-97939627 TTGTGAGAGGCTCTGAGTGTTGG - Intronic
1073036192 10:100565622-100565644 CTGAGGTAGGCTATGAGTGGAGG + Intergenic
1073462614 10:103675141-103675163 GCCTTGGAGGCTCTGAGTGTAGG - Intronic
1074369604 10:112889271-112889293 CCTTGGGAGGCTCTGGTGGGAGG + Intergenic
1074869613 10:117566434-117566456 CCTGGGGATGCTCTGATTGGGGG + Intergenic
1076002650 10:126924357-126924379 TAGTGGGAGGCTGTGAGTGCTGG + Intronic
1076384437 10:130046341-130046363 CCGGGGGAGGCGCTGGGCGGGGG - Intergenic
1076737702 10:132466122-132466144 CCCTTGGTGGCTCTGAGTGAGGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077360607 11:2138852-2138874 CCGGGGGAGGCGGTGACTGGGGG + Intronic
1078326763 11:10387573-10387595 CCGTGAGATGCTCTGTGTGGCGG - Intronic
1079029745 11:16977648-16977670 GGGTGGGAGGCTCTGAGTTGGGG - Intronic
1079133379 11:17762375-17762397 AGGTGAGAGGCTCTGTGTGGAGG + Intronic
1083844296 11:65321879-65321901 CCGTTGGATGCCCTGACTGGGGG + Exonic
1084041143 11:66543435-66543457 TCGTGGGAGTCTCTGCATGGCGG - Intronic
1084288495 11:68146885-68146907 CCCTGGGAGGCCCTGAGGAGTGG - Intergenic
1084342345 11:68514308-68514330 CTTTGGGAGGCTCTGACGGGTGG - Intronic
1084377166 11:68785275-68785297 CAGTGGGAGGCTGGGAGTGGTGG + Intronic
1085164626 11:74386762-74386784 CTGTGGGAGGCTGGGTGTGGTGG - Intronic
1087058077 11:93952798-93952820 TCTGGGGAGGCTCTGACTGGGGG + Intergenic
1089922910 11:122227839-122227861 CTGTGGGAGGCTGAGAGAGGTGG - Intergenic
1090210858 11:124920410-124920432 CCGAGGGAGGCTGTGGGAGGAGG + Exonic
1090803339 11:130188074-130188096 GGGTGAGAGGGTCTGAGTGGTGG + Intronic
1092145459 12:6211528-6211550 GCGTGCGTGGCCCTGAGTGGTGG - Intronic
1095457196 12:42400616-42400638 CTTTGGGAGGCTCAGAGAGGAGG - Intronic
1095624366 12:44297062-44297084 CTGTGGGAGGATATGAGTAGAGG + Intronic
1096365559 12:51026167-51026189 CCGTGCGGGGCTGTGAGGGGAGG - Intronic
1097259965 12:57713534-57713556 CTGTGGGTGGGGCTGAGTGGAGG + Intronic
1097441313 12:59612075-59612097 CCGATGGAGACTCTGTGTGGAGG + Intronic
1098360098 12:69646179-69646201 CCTTGGGAGGCTGAGACTGGTGG - Intronic
1099475589 12:83104293-83104315 CCGTGGGGGGTTCTATGTGGCGG + Intronic
1101157394 12:101940635-101940657 ACGTGGGAGGCTCTGTGTAGGGG - Intronic
1101157415 12:101940866-101940888 ACGTGGGAGGCTCTGCGTAGGGG - Intronic
1104792254 12:131490987-131491009 CAGTGGGAGGCTGTGATTGGTGG - Intergenic
1105054106 12:133081163-133081185 ACGTGGGAGGCGCGGAGCGGGGG + Intronic
1105541537 13:21320870-21320892 CCGTGGGGGCCTCTGGCTGGGGG - Intergenic
1106117050 13:26826668-26826690 AGGAGGGAGGCTCTGAGTGTTGG - Intergenic
1112235003 13:97627807-97627829 CAGTGAGAGGCTCTGGGTAGAGG - Intergenic
1113048529 13:106183189-106183211 CCATGGGATGCTCTGGGTGAAGG - Intergenic
1113438500 13:110310975-110310997 CCCTGGGAAGCTCGGTGTGGAGG - Intronic
1113894601 13:113755543-113755565 CCCTGGGCTGCTCTCAGTGGTGG + Intergenic
1113912896 13:113852701-113852723 CTGTGGGTGGCTTTGAGCGGGGG - Intronic
1114340396 14:21736914-21736936 CCGGGGCAGGCTCAGAGTGCTGG - Intergenic
1114665068 14:24372794-24372816 CCATGGGATGAGCTGAGTGGGGG - Intronic
1115174613 14:30547796-30547818 CGGCCGGAGGCTCTGAGTGTGGG + Intergenic
1118053271 14:62051921-62051943 CCTTGGGAGGCTGAGTGTGGAGG + Intronic
1120840761 14:89083040-89083062 CTGTGGCAGGCTCTGGGAGGGGG + Intergenic
1120894143 14:89514775-89514797 ACATGGGAGGCACTGAGTGAAGG - Intronic
1121185270 14:91962091-91962113 CCGCGGGTGGATCTGAGTGTAGG + Intergenic
1122495571 14:102152157-102152179 CTGTGGGAGGCTGTGATGGGAGG - Intronic
1122610837 14:102982341-102982363 CTGTGGGAGGCCCTGGCTGGAGG + Intronic
1122856775 14:104563786-104563808 CCATGTGAGGCTGTGTGTGGGGG + Intronic
1123161948 14:106287125-106287147 CCGTGGGCAGCTCTGCGTCGAGG + Intergenic
1123906504 15:24926759-24926781 CCGTGGGAGGCTGAGATGGGTGG + Intronic
1124848738 15:33315548-33315570 CCTTGGGAGGCCCAGAGTGTGGG - Intronic
1124976634 15:34533089-34533111 AGGTAGGAGGCTCTGGGTGGAGG - Intronic
1125894639 15:43292410-43292432 CGGTGGGTGTCTCTGAGTAGTGG - Intronic
1126798920 15:52282678-52282700 CCGTGGGAGGCACCCAGGGGAGG - Intronic
1129933576 15:79431766-79431788 CCGCGGGTGGCTCCGGGTGGTGG + Intergenic
1130132896 15:81158884-81158906 GTGTGGGAGGCTCAGAATGGCGG - Intergenic
1130545877 15:84857491-84857513 TGGTGGGTGACTCTGAGTGGGGG - Exonic
1130904223 15:88228550-88228572 CTGTGGTGGGATCTGAGTGGTGG - Intronic
1131174386 15:90201106-90201128 CGGTGGGAGGGTCTGAGCAGTGG + Intronic
1131221534 15:90588705-90588727 CCGTGGGAGGCTCAGAATGCTGG + Intronic
1131398300 15:92104403-92104425 CCATGGCGGGCTCTGAGTGCGGG - Exonic
1131461083 15:92617914-92617936 CCGTGGGAAGCCCTGGGTGAGGG - Exonic
1131576188 15:93593760-93593782 CTGTGACCGGCTCTGAGTGGAGG - Intergenic
1132407802 15:101554823-101554845 CCGTTGGCGTCTCTGAGAGGAGG + Intergenic
1132415480 15:101615867-101615889 CCCTGGGAGGGTCTGAGCTGTGG - Intergenic
1132501430 16:286224-286246 CAGGGGGAGGTTCTGTGTGGGGG - Intronic
1132691070 16:1182192-1182214 AGGTGGGAGGCTCTGCGGGGTGG + Intronic
1134069184 16:11250138-11250160 CCTGGGGAGGCTCCGAGTGATGG + Intronic
1134307905 16:13049824-13049846 ACTTGGGAGGGTCTGAATGGGGG + Intronic
1134514901 16:14879240-14879262 CAGTCGGAGGCCCTGACTGGTGG + Intronic
1134702578 16:16277889-16277911 CAGTCGGAGGCCCTGACTGGTGG + Intronic
1134762571 16:16727181-16727203 CTGTGAGAGCCTCTGAGTAGAGG - Intergenic
1134964965 16:18434226-18434248 CAGTCGGAGGCCCTGACTGGTGG - Intronic
1134969252 16:18516761-18516783 CAGTCGGAGGCCCTGACTGGTGG - Intronic
1134983482 16:18631973-18631995 CTGTGAGAGCCTCTGAGTAGAGG + Intergenic
1135591227 16:23706348-23706370 CCATGGGGGGCGCTGAGTAGCGG + Exonic
1136383201 16:29906652-29906674 CTTCGGAAGGCTCTGAGTGGTGG + Exonic
1136537531 16:30909072-30909094 CAGTGTGAGGCTCGGAGAGGAGG + Intergenic
1136852223 16:33621218-33621240 ACCTGGGAGGCTCAGAGGGGAGG - Intergenic
1139448556 16:67013639-67013661 CCGTGGGAGGACCTGAGTGGGGG - Intergenic
1139683070 16:68580569-68580591 CCCTGTGAGGATCTCAGTGGTGG - Intergenic
1140442287 16:74997634-74997656 CTGTGGGAGGCTGGGGGTGGGGG - Intronic
1141569853 16:84928011-84928033 CTGTGGGAGGGTCTGAGTGAGGG - Intergenic
1142370821 16:89680453-89680475 CTGTGGGAGGCCCGGAGCGGTGG - Intergenic
1142379396 16:89722917-89722939 CCGCGGGAGCCTCTGGGTGGGGG + Intronic
1142515224 17:423370-423392 CCGTGAGAGGCTCTGGTTGTCGG + Intronic
1142553046 17:752524-752546 CCGGGGGAGGCGCTCGGTGGGGG - Intronic
1143369318 17:6428572-6428594 CCAGGAGGGGCTCTGAGTGGAGG - Intronic
1144581683 17:16462858-16462880 CCTTGGGGGTTTCTGAGTGGTGG + Intronic
1144659723 17:17060251-17060273 CCCTGGGAGGCTGCAAGTGGGGG - Intronic
1144698199 17:17320127-17320149 ACGTGGGAGGCTGGGCGTGGTGG - Intronic
1145308893 17:21690583-21690605 CCGGCTGAGGCTCTGAGTTGTGG + Intergenic
1147363609 17:39946260-39946282 CCAGGGGAGGCTCTCAGTAGAGG - Intergenic
1147422981 17:40331807-40331829 CCCTCAGAGGCACTGAGTGGGGG - Intronic
1148192971 17:45692711-45692733 CCCTGAGGTGCTCTGAGTGGAGG + Intergenic
1149598973 17:57881110-57881132 CCCTGGGAGGCTGTGTGTGCTGG - Intronic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1150475399 17:65471007-65471029 CTGTGGGAGGCTCTGCCTGGAGG - Intergenic
1150626940 17:66847954-66847976 CCGGGGTAGGCTGTGAGTGATGG + Intronic
1151375594 17:73686680-73686702 CCATTGGAGACTCTGTGTGGGGG - Intergenic
1151829694 17:76542357-76542379 CCGTGGAAGGCTGGCAGTGGGGG + Intronic
1152190740 17:78885824-78885846 CTGGTGGAGGCTCTGGGTGGAGG + Intronic
1152441059 17:80310038-80310060 CCATGGGAGGCTGGGCGTGGTGG - Intronic
1154276572 18:12966506-12966528 ACTTGGGAGGCTGTGTGTGGTGG - Intronic
1156677709 18:39550690-39550712 CCTTGAGAGGGTCTGAGTAGAGG - Intergenic
1156783657 18:40882446-40882468 ACGTGGGGTGCTGTGAGTGGGGG - Intergenic
1157077279 18:44479639-44479661 CCATTGGAGACTCTGTGTGGGGG - Intergenic
1157710818 18:49848480-49848502 TGAAGGGAGGCTCTGAGTGGAGG + Intronic
1157763649 18:50282236-50282258 CCGTGGGAGGCTGGGAATGTGGG + Intergenic
1158547117 18:58405825-58405847 CCGTGGGAGGCTCTGGCAGGTGG - Intergenic
1160146274 18:76367569-76367591 ACGTGGAAGGCCCGGAGTGGAGG - Intronic
1160295202 18:77631082-77631104 CCAGGGGAGACTCTGTGTGGGGG + Intergenic
1160450372 18:78959604-78959626 CCGTGGCAGGATCTGAGAGACGG - Intergenic
1160540266 18:79617244-79617266 GCTTGGGGGGCTCTGAGTGGGGG - Intergenic
1160840920 19:1146748-1146770 CAGTGGGAGGCTGTGAGGGTGGG + Intronic
1161202497 19:3023643-3023665 CCGTGTCAGGCTCCGAGTGTTGG - Intronic
1161723427 19:5915690-5915712 AGGTGGGAGGCTGTGTGTGGAGG + Exonic
1162836011 19:13318467-13318489 CCGTGGAGGGTTCTGAGTAGAGG + Intronic
1163340705 19:16705000-16705022 CTTTGGGAGGCTTGGAGTGGGGG + Intergenic
1163578874 19:18126317-18126339 CAGGGGGAGGCTCTGGGAGGAGG + Intronic
1163672659 19:18637638-18637660 CTGTGGGAGGCTCTGGGTGGGGG + Intronic
1163794210 19:19327096-19327118 CCTGGGGAGGCTGTGTGTGGTGG - Intronic
1164506642 19:28866706-28866728 ACGTAAGAGGATCTGAGTGGAGG + Intergenic
1165434560 19:35788926-35788948 TCCTGGGAGCCTCTGAGAGGTGG + Intergenic
1165639510 19:37372240-37372262 CTGTGGGAGGCTCTGGTGGGCGG - Intronic
1165707705 19:37988175-37988197 CCATGGGAGGTTCTGAGCAGGGG - Intronic
1166831811 19:45643793-45643815 ACCTGGGAGGCGCTGAGTGGGGG - Intronic
1167985469 19:53311066-53311088 CCTTGTGAGACCCTGAGTGGAGG - Intergenic
1168299529 19:55396160-55396182 CCTTGGGAGGCTGAGATTGGAGG + Intronic
1168441081 19:56367980-56368002 TCGTGGGAGGCTTTAAGAGGGGG - Intronic
925101365 2:1248985-1249007 CCTTGGGATGCTCCGAGTGCTGG + Intronic
927957566 2:27218189-27218211 CCTTGGGAGGCACAGAGTGTTGG + Intronic
929114215 2:38430835-38430857 CCATGGGGGGCTCTGAGCGATGG + Intergenic
930369019 2:50480654-50480676 CCTTAGGAGTCTTTGAGTGGTGG - Intronic
932132607 2:69201384-69201406 GAGTGGGAGGCACTGAGAGGAGG + Intronic
932137407 2:69243277-69243299 CCCTGTGAGGCTGTGAGTTGTGG + Intronic
934047820 2:88186686-88186708 CCCTGGGGGCCGCTGAGTGGTGG + Intergenic
934571723 2:95376818-95376840 ACGTAGGAGGCTCTGAGGGCTGG - Intronic
934710752 2:96512478-96512500 TGGTGGGAGGCTCTGAGCGCTGG + Intergenic
935292246 2:101620533-101620555 CTGGGGAAGGCTCTGTGTGGAGG - Intergenic
936750498 2:115635407-115635429 CCGAGGGAGGCGGTGAGTGATGG - Intronic
937854158 2:126660603-126660625 CTGTGACAGGCCCTGAGTGGGGG - Intronic
939667126 2:144965683-144965705 CCCAGGGGGGCTCTGTGTGGAGG - Intergenic
941017793 2:160376742-160376764 ACGTGGGAGGCTGTGACAGGAGG - Intronic
942081407 2:172402702-172402724 GAGTAAGAGGCTCTGAGTGGAGG - Intergenic
943311314 2:186328440-186328462 GCGTGGCAGGGTCTGATTGGAGG + Intergenic
945527105 2:210902028-210902050 CCGTGGGGTGCTCTCAGTGCAGG + Intergenic
946250076 2:218406364-218406386 CGGGGCGAGGCTCTGGGTGGAGG + Intergenic
948045288 2:234939052-234939074 CCCTGGGAGCCTCTGTGTGTGGG + Intergenic
948081288 2:235207362-235207384 CCCTGGGGGGCTCTTAGTGCTGG - Intergenic
948771235 2:240252247-240252269 CCGTGGGAGCCGCTGAGACGTGG + Intergenic
948845650 2:240681695-240681717 CAGACGGAGGGTCTGAGTGGAGG + Intronic
948848205 2:240693035-240693057 CAGACGGAGGGTCTGAGTGGAGG - Intronic
949047982 2:241880899-241880921 CCCTGGGAGGCTCTGCCTCGGGG + Intergenic
1169913056 20:10662739-10662761 CCGTGGGGGGGTGTGTGTGGGGG - Intronic
1173819932 20:46013349-46013371 CTGTGGGGCGCTCTGAGGGGTGG - Exonic
1174485653 20:50859574-50859596 CAGTGGGAGGCTCAGCCTGGAGG + Intronic
1174674925 20:52344576-52344598 CCATGGGAGGCTTTGAGAAGAGG + Intergenic
1175414072 20:58789991-58790013 CCGTGGTAGGCACTGTGGGGGGG + Intergenic
1175986199 20:62765258-62765280 CGGAGGGAGGCTCAGAGGGGAGG - Intergenic
1177640327 21:23836416-23836438 CCGTGGACAGCTCTGAGTGGTGG + Intergenic
1179966605 21:44810466-44810488 CCGTGGGAGGCACAGGGTTGTGG - Intronic
1181011111 22:20041066-20041088 CAGGGGCAGGCACTGAGTGGGGG + Intronic
1182121553 22:27790487-27790509 CCCTGGGTGGCTCTGAGCTGGGG + Intronic
1183380270 22:37487165-37487187 CCAGTGCAGGCTCTGAGTGGAGG - Intergenic
1184330111 22:43821833-43821855 CAGAGGGTGGCTCAGAGTGGAGG + Intergenic
1184437935 22:44490874-44490896 GCGTGGGGGGCTCTGTGTAGGGG - Intergenic
1184571191 22:45325969-45325991 CAGTGGGAGGGTTTGGGTGGTGG + Intronic
1184820861 22:46908315-46908337 CCCTGGGATTCTCTGAGGGGCGG + Intronic
949518948 3:4832221-4832243 CTGGGGGAGACTCTGTGTGGTGG + Intronic
950190780 3:10974776-10974798 CCGTGCAAAGCTCTGAGAGGAGG + Intergenic
950234433 3:11306462-11306484 GCCTGGGAGGGTCTGAGAGGTGG + Intronic
950424429 3:12917165-12917187 GCGTGGAAGGCTATGAGTGTCGG - Intronic
952730529 3:36633531-36633553 GTGAGGGAGGCTCTGTGTGGTGG - Intergenic
953141981 3:40237564-40237586 CTGTGTCAGGCTCTGGGTGGTGG - Intronic
953710183 3:45263463-45263485 CCGTGGAAGCCTCTGATTGTTGG - Intergenic
954677608 3:52324430-52324452 CCAGGAGAAGCTCTGAGTGGTGG + Intronic
954813272 3:53261010-53261032 CCGTGGGAGGCTTAGAGAGTGGG + Intergenic
958151713 3:89700876-89700898 CCAGGGGAGACTCTGTGTGGAGG + Intergenic
960129956 3:114045294-114045316 CAGTGGGAGGCTGTTGGTGGTGG - Intronic
960477337 3:118145337-118145359 CCAAGGGAGGCTGTGAGTGAGGG - Intergenic
962283421 3:134068504-134068526 CCTTGGGAGTCTTTGACTGGGGG - Intronic
962810018 3:138951603-138951625 CCGTGGGATGCTCTCAGAGGCGG + Exonic
966388298 3:179425278-179425300 CGTGGGGAGGCTCTGAGAGGAGG - Intronic
968044412 3:195616019-195616041 ATGGGGGAGGCTGTGAGTGGTGG - Intergenic
968060201 3:195722070-195722092 ATGGGGGAGGCTGTGAGTGGTGG - Intronic
968284258 3:197498973-197498995 CCCAGGGAGCCGCTGAGTGGGGG + Intergenic
968493003 4:900577-900599 CCTGAGGAGTCTCTGAGTGGTGG - Intronic
968519605 4:1029544-1029566 CCGGGGGAGGCTCAGCATGGCGG + Intergenic
968632863 4:1661218-1661240 CCGTGGGAGCCTGTGAGGGTGGG - Intronic
968698473 4:2043707-2043729 GAGTGGGAGGCTCTGGGTGTGGG + Intronic
968735855 4:2296240-2296262 CCCTGCAAGGCCCTGAGTGGTGG - Intronic
968977750 4:3830750-3830772 CCATGGGGAGCTCTGGGTGGAGG + Intergenic
969254526 4:5993041-5993063 CCTTGGGAGGCTCACAGTCGGGG - Intergenic
969711374 4:8846217-8846239 CAGTGGGAGCCTCTGGATGGCGG - Intronic
969848077 4:9935387-9935409 CTGTGGGAGCCTATGGGTGGTGG + Intronic
970456121 4:16226216-16226238 CCGTGGCGGGCTCCGAGGGGCGG - Intronic
978525407 4:109659899-109659921 CTTTGGGAGGCTCAGATTGGTGG - Intronic
978713829 4:111817641-111817663 CCTTGTGAGACTCTGAGTAGAGG + Intergenic
981061410 4:140429125-140429147 AGGTGGGAGGCTCTGAAGGGGGG - Intergenic
982713220 4:158779825-158779847 CTTTGGGAGGCTCAGGGTGGGGG - Intronic
984890313 4:184486268-184486290 CAGTGGGTGTCTCTGAGTGATGG + Intergenic
986666663 5:10110343-10110365 CCGTCTGAGGCTGTGAGGGGAGG - Intergenic
987402987 5:17497453-17497475 CAGGGCGAGTCTCTGAGTGGTGG - Intergenic
993109844 5:83643488-83643510 CCGTGTGGGGCCCTGTGTGGTGG - Intronic
995851449 5:116550449-116550471 CCATGGCAGGCTCTGAGGGCTGG + Intronic
998163660 5:139828079-139828101 GCCTGGGATGCACTGAGTGGGGG + Intronic
999129437 5:149271776-149271798 CCGGGAGCGGCTCTGAGGGGCGG + Intergenic
1000309588 5:160029396-160029418 CCTTGGGAGGCTCTGGTGGGAGG + Intronic
1004427787 6:15517786-15517808 CTGGGGGCCGCTCTGAGTGGCGG + Intronic
1007119727 6:39369913-39369935 CCGAGCCAGGCTCTTAGTGGTGG - Intronic
1007420585 6:41716858-41716880 CTGTGGGGGACTCTGAGTGATGG - Intronic
1007719970 6:43879103-43879125 CTGTAGGAAGCTCTGAGAGGAGG + Intergenic
1012249906 6:96968675-96968697 CAGTGGGAGAGTCTGAGAGGTGG - Intronic
1016790195 6:148059964-148059986 CCGTTGGGGACTCTGTGTGGGGG + Intergenic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1018176075 6:161180420-161180442 CTGTGGGAGGTTCTGACTGTTGG - Intronic
1018284490 6:162222632-162222654 CCTTGTGAGACCCTGAGTGGAGG + Intronic
1018766059 6:166933592-166933614 CCTTGGGAGGCTCAGGCTGGAGG - Intronic
1018802696 6:167236137-167236159 CGGGAGGAGGCTCTGCGTGGGGG - Intergenic
1019984650 7:4646810-4646832 CCATGAGAGGCTCTGAGCAGAGG + Intergenic
1020015936 7:4831955-4831977 CCCTGGGAAGCTCTGAGTTTTGG - Intronic
1023137672 7:37069099-37069121 CCCTGGGAGCCTCCCAGTGGTGG + Intronic
1023844662 7:44113919-44113941 GCGTGGGAGGCACAGTGTGGGGG - Exonic
1024479372 7:49848279-49848301 CCGTGGGAGGCTCTGAGTGGAGG - Intronic
1026562527 7:71462267-71462289 AAGTGTCAGGCTCTGAGTGGAGG - Intronic
1027050134 7:75016584-75016606 CTCAGGGAGGCTCTGGGTGGAGG - Intronic
1029382900 7:100225084-100225106 CCCAGGAAGGCTCTGGGTGGAGG + Intronic
1029478944 7:100801514-100801536 CCTTGGGAGGCTGGGAGGGGAGG + Intergenic
1029841913 7:103373827-103373849 CAGTGGTAATCTCTGAGTGGTGG + Intronic
1029975489 7:104829158-104829180 TCATGGGAGGCTCTTAATGGGGG - Intronic
1031691616 7:124795002-124795024 CCTTGGGAGGCTGAGACTGGAGG - Intergenic
1031702464 7:124942910-124942932 CCGGTGGAGACTCTGTGTGGGGG - Intergenic
1031733297 7:125324664-125324686 CCTTGGGAGACTTTGAGTGTGGG + Intergenic
1034253959 7:149714553-149714575 ACATGGGACGCGCTGAGTGGTGG + Intergenic
1034264444 7:149774083-149774105 CCGGGGGAGGGTCTGGGAGGGGG + Intergenic
1035174971 7:157044097-157044119 CCAAGGGAGGCTGTGGGTGGAGG - Intergenic
1035671017 8:1417140-1417162 GCGGGGGAGACTCTGAGTGAAGG + Intergenic
1035671030 8:1417191-1417213 GCGGGGGAGACTCTGAGTGAGGG + Intergenic
1035766435 8:2109913-2109935 CCATGGGAAGCTGTCAGTGGGGG - Intronic
1038842346 8:31196803-31196825 CTGTGGGAGGCTCTTAATGGGGG - Intergenic
1040101769 8:43512380-43512402 CCTTGAGTGGCTCTGAGTGTGGG + Intergenic
1041786205 8:61637216-61637238 CTGTGGGTGACTCTGCGTGGGGG - Intronic
1042174147 8:66022320-66022342 CCCTGAGAGGCTCTGAGTGACGG + Intronic
1044247301 8:89963966-89963988 CTGTGTGAGGATCTGGGTGGTGG - Intronic
1044678830 8:94756778-94756800 CTGTGGGAGGCTGAGAGGGGCGG + Intronic
1045676785 8:104615791-104615813 CCTTGGGAGGCTCAGATAGGAGG + Intronic
1047655427 8:126971811-126971833 CAGTGGGAGGGTCTGGGTGAGGG + Intergenic
1048304595 8:133274917-133274939 GCGTGGGAGGCCCTCAGTGCTGG + Intronic
1048970936 8:139644718-139644740 CAGTGGGAGGCTCTGGGGGGGGG - Intronic
1049148534 8:141019668-141019690 CTGGGGGAGGTTCTGGGTGGGGG - Intergenic
1049187919 8:141268523-141268545 CTGGGGGAGGCTGGGAGTGGGGG + Intronic
1049229053 8:141472737-141472759 CCCTGGGAGGATCTGGGAGGAGG + Intergenic
1049277922 8:141729211-141729233 CCTTGGGAGCCCCAGAGTGGAGG + Intergenic
1049454998 8:142682280-142682302 CCATGGGAGGGTCAGGGTGGGGG - Exonic
1049534151 8:143170288-143170310 CTGTGGGTGGCACTCAGTGGTGG + Intergenic
1049685717 8:143938569-143938591 CTGTGGGAGGCGCTGAGGGAGGG - Intronic
1050654359 9:7809972-7809994 CCATGCCAGGCTCTGAGTGCAGG - Intronic
1051068386 9:13132446-13132468 CCTTGGGAGGTTCTGAGTAGGGG + Intronic
1052930556 9:34052044-34052066 CAGTGGCTGGCTCTGAGGGGTGG + Intergenic
1055424039 9:76174551-76174573 CCTTGGGAGGCTGAGACTGGTGG - Intronic
1056950689 9:91038727-91038749 ACGTGTGAGCCTGTGAGTGGTGG + Intergenic
1061147060 9:128806202-128806224 ACCTGGGATGCTCTGAGTGCAGG - Intronic
1061370723 9:130195991-130196013 CAGTTGGAGGCTCTGGGAGGAGG + Intronic
1062063355 9:134511630-134511652 CAGTGGGAGACTTTGAGAGGAGG - Intergenic
1062339844 9:136089186-136089208 CAGGGGGAGGCTCTGGGTGGGGG - Intronic
1062551537 9:137089733-137089755 CCGTGGGAAAAGCTGAGTGGGGG + Intronic
1062609918 9:137369106-137369128 GCGTGGGAGTCTCGGAGTCGTGG + Intronic
1062622400 9:137428798-137428820 CCGAGGGAGGAGCTGGGTGGGGG + Intronic
1062638687 9:137505694-137505716 CCGTGTGACTCTCTGAGTGCTGG + Exonic
1187193710 X:17060665-17060687 GCTGGGGAGGCTCTGAGAGGGGG + Intronic
1189305722 X:39985234-39985256 GCGTGCGAGGCACAGAGTGGGGG - Intergenic
1189938804 X:46098886-46098908 CCCCAGGAGGCTCTGAATGGTGG - Intergenic
1192001271 X:67154605-67154627 CTGTTGGATGCTCTGAGAGGGGG - Intergenic
1197715901 X:129705810-129705832 CTGTGGGAGGAGCTGAGTGTGGG + Intergenic
1197769643 X:130082003-130082025 TCGTGTGAGGGGCTGAGTGGGGG + Intronic
1199423649 X:147676355-147676377 CCGTTGGGGACTCTGGGTGGCGG - Intergenic
1200165164 X:154030696-154030718 CCTTTGGGGACTCTGAGTGGTGG + Exonic
1201767030 Y:17581519-17581541 CCTTGGGAGGCTGAGACTGGAGG - Intergenic
1201834523 Y:18324466-18324488 CCTTGGGAGGCTGAGACTGGAGG + Intergenic