ID: 1024480833

View in Genome Browser
Species Human (GRCh38)
Location 7:49860849-49860871
Sequence GTGAGGCCACAGAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024480827_1024480833 7 Left 1024480827 7:49860819-49860841 CCAAGGATGTGTGCACAGAGAAA 0: 1
1: 2
2: 9
3: 47
4: 287
Right 1024480833 7:49860849-49860871 GTGAGGCCACAGAAGGAAGGTGG No data
1024480824_1024480833 27 Left 1024480824 7:49860799-49860821 CCCTATAAGAAGAAGAGACACCA 0: 6
1: 25
2: 68
3: 112
4: 431
Right 1024480833 7:49860849-49860871 GTGAGGCCACAGAAGGAAGGTGG No data
1024480825_1024480833 26 Left 1024480825 7:49860800-49860822 CCTATAAGAAGAAGAGACACCAA 0: 1
1: 0
2: 6
3: 32
4: 278
Right 1024480833 7:49860849-49860871 GTGAGGCCACAGAAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024480833 Original CRISPR GTGAGGCCACAGAAGGAAGG TGG Intronic
No off target data available for this crispr