ID: 1024482857

View in Genome Browser
Species Human (GRCh38)
Location 7:49883210-49883232
Sequence AGGTTCCGCTTGGCAGGTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024482857_1024482868 7 Left 1024482857 7:49883210-49883232 CCCGAACCTGCCAAGCGGAACCT 0: 1
1: 0
2: 1
3: 9
4: 92
Right 1024482868 7:49883240-49883262 GGAGGCGTCTTTCCAGAGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 124
1024482857_1024482872 28 Left 1024482857 7:49883210-49883232 CCCGAACCTGCCAAGCGGAACCT 0: 1
1: 0
2: 1
3: 9
4: 92
Right 1024482872 7:49883261-49883283 GGGCCAGAATAGGCGAATCCAGG No data
1024482857_1024482873 29 Left 1024482857 7:49883210-49883232 CCCGAACCTGCCAAGCGGAACCT 0: 1
1: 0
2: 1
3: 9
4: 92
Right 1024482873 7:49883262-49883284 GGCCAGAATAGGCGAATCCAGGG 0: 1
1: 0
2: 26
3: 86
4: 217
1024482857_1024482870 18 Left 1024482857 7:49883210-49883232 CCCGAACCTGCCAAGCGGAACCT 0: 1
1: 0
2: 1
3: 9
4: 92
Right 1024482870 7:49883251-49883273 TCCAGAGCAGGGGCCAGAATAGG No data
1024482857_1024482869 8 Left 1024482857 7:49883210-49883232 CCCGAACCTGCCAAGCGGAACCT 0: 1
1: 0
2: 1
3: 9
4: 92
Right 1024482869 7:49883241-49883263 GAGGCGTCTTTCCAGAGCAGGGG 0: 1
1: 0
2: 1
3: 16
4: 128
1024482857_1024482867 6 Left 1024482857 7:49883210-49883232 CCCGAACCTGCCAAGCGGAACCT 0: 1
1: 0
2: 1
3: 9
4: 92
Right 1024482867 7:49883239-49883261 GGGAGGCGTCTTTCCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024482857 Original CRISPR AGGTTCCGCTTGGCAGGTTC GGG (reversed) Intronic
900079717 1:846914-846936 AGGCTCCACCTGGCATGTTCTGG - Intergenic
904359108 1:29960837-29960859 AGGTTCAGCTGGGCACCTTCAGG - Intergenic
904776944 1:32915444-32915466 AGGCTCCGCCTCCCAGGTTCAGG + Intergenic
904915713 1:33968974-33968996 ATGTCCCCCTTGGCATGTTCTGG + Intronic
906162376 1:43659856-43659878 AGCTTCCTTTTGGCTGGTTCAGG + Intronic
912447944 1:109751776-109751798 TGGTGACTCTTGGCAGGTTCTGG - Exonic
912709727 1:111941709-111941731 AGGTTCCCCTTCCCAGGGTCAGG - Intronic
912950975 1:114119987-114120009 AAGTTCCGCCTCCCAGGTTCAGG - Intronic
916198150 1:162244218-162244240 AGATTCTGCTTGACAGGTGCTGG + Intronic
921160017 1:212465908-212465930 AGGGTTCGCTTGGGAGGTCCTGG + Intergenic
921447253 1:215261208-215261230 AGGTACTGCTTAGCAGGTGCTGG + Intergenic
922660512 1:227425770-227425792 AGGTCCTGCATGGCAGTTTCGGG - Intergenic
924948967 1:248865327-248865349 AGGATCCCCTTGGCTGGTTATGG - Intergenic
1063123901 10:3123828-3123850 AGGCTCTGCCTGGCAGGCTCTGG - Intronic
1072433959 10:95398588-95398610 AGGTCCCTTTTGACAGGTTCAGG - Intronic
1073423546 10:103442663-103442685 AGGTTACCCTTAGCAGTTTCAGG - Intronic
1073483972 10:103805081-103805103 GGGCTCCGCTTGGTTGGTTCCGG - Intronic
1076259301 10:129053133-129053155 AAGCTCCGCTTCCCAGGTTCAGG + Intergenic
1077953345 11:6986504-6986526 AGGTTCCACTTGTCAGTTTTTGG - Intergenic
1084399445 11:68935178-68935200 AGGCTCCGCTTCCCAGGTCCTGG + Intronic
1088837597 11:113591065-113591087 AGGTTCTCCTGGGCAGGCTCAGG - Intergenic
1089437532 11:118483149-118483171 AGCCTCCGCCTCGCAGGTTCAGG - Intronic
1091266632 11:134276629-134276651 CGGTTCCGCGGGGCAGGCTCAGG - Intronic
1097999548 12:65925023-65925045 AGGGTCTGCTTGGAAGCTTCTGG - Intronic
1103025700 12:117572043-117572065 GGGTTCTGCTTTGCAGCTTCAGG - Intronic
1105451687 13:20505524-20505546 AGGTTCAGGCTAGCAGGTTCAGG + Intronic
1107250060 13:38349560-38349582 AGGTTCCAGTTGGCAGGTTGGGG - Intergenic
1111860944 13:93705023-93705045 TGGTTCCTCTAGGCATGTTCAGG + Intronic
1111991906 13:95124794-95124816 AGCTTCCGCCTCCCAGGTTCAGG - Intronic
1121823780 14:96993601-96993623 GGGCTCCACTGGGCAGGTTCTGG + Intergenic
1127322127 15:57856989-57857011 AGATTCCGCGTGTCAGGTTAAGG - Intergenic
1127417552 15:58771802-58771824 CAGTTCTGCTTGGCAGGTGCCGG - Exonic
1128271926 15:66318053-66318075 AAGTTCCGCCTCCCAGGTTCAGG + Intronic
1128460055 15:67860104-67860126 AGGCTCTGGTTGGCATGTTCAGG - Intergenic
1129381592 15:75171116-75171138 AGGTTTCACCTGGCAGGTGCGGG + Intergenic
1135282564 16:21165327-21165349 AACTTCCGCTTCCCAGGTTCAGG - Intronic
1142486942 17:253579-253601 AGTTTCAGTTTGGCAAGTTCTGG - Intronic
1142956605 17:3527168-3527190 TAGTACCGCTTTGCAGGTTCTGG - Intronic
1144619142 17:16805159-16805181 AGGTTACATTTGGCAGGGTCTGG - Intergenic
1144893556 17:18510536-18510558 AGGTTACATTTGGCAGGGTCTGG + Intergenic
1145138669 17:20433738-20433760 AGGTTACATTTGGCAGGGTCTGG - Intergenic
1145935703 17:28713606-28713628 AAGCTCCGCCTGCCAGGTTCAGG + Intergenic
1146839027 17:36136698-36136720 AGGTTCCTTTTGGCAGGTCCAGG - Intergenic
1146939962 17:36837460-36837482 AGGTTCTGCTTGGCTGGTTGTGG - Intergenic
1146980899 17:37160595-37160617 AAGTTCAGCTGGGCAGGTGCAGG + Intronic
1147056039 17:37836021-37836043 AGGTTACATTTGGCAGGGTCTGG + Intergenic
1148163520 17:45465856-45465878 AGCTTCTGCTTTGCAGGCTCAGG - Intronic
1148569988 17:48660509-48660531 AGCTTCCCCTTCCCAGGTTCAGG - Intergenic
1150394747 17:64812508-64812530 AGCTTCTGCTTTGCAGGCTCAGG - Intergenic
1150780559 17:68118060-68118082 AGCTTCTGCTTTGCAGGCTCAGG - Intergenic
1156320233 18:36014269-36014291 AGCTTCCGCTTGGAAGTTTCTGG - Intronic
1158542985 18:58373702-58373724 AGGCTCAGCATGGCAGGCTCCGG + Intronic
1162413608 19:10520700-10520722 AACTTCCGCCTGCCAGGTTCAGG - Intergenic
1163588112 19:18174897-18174919 AGATTCCACCTGGCAAGTTCTGG + Intronic
1165712571 19:38022624-38022646 AGGCTCCGCCTCCCAGGTTCAGG - Intronic
925283045 2:2698232-2698254 AGGTTCGTCATGTCAGGTTCAGG - Intergenic
928086206 2:28347892-28347914 AAGCTCCGCTGGGCAGGTTCTGG - Intergenic
948045596 2:234941164-234941186 AGGTTCCGATTGGCTGGTCCTGG + Intergenic
1172433025 20:34908225-34908247 TGGTTTCCCTTGGCAAGTTCAGG - Intronic
1172856777 20:38010550-38010572 AAGCTCCGCTTCCCAGGTTCAGG + Intronic
1174072320 20:47908084-47908106 AGGTCCCACATGACAGGTTCTGG + Intergenic
1179334250 21:40435194-40435216 GGATTCCGCTTGGCAGCTGCGGG - Intronic
1183449268 22:37882593-37882615 AGCTTCTGCTTCCCAGGTTCAGG - Intronic
1184539968 22:45115256-45115278 AGGTTCAGCTTGTCAATTTCTGG - Intergenic
954869742 3:53758748-53758770 TGGTTCCACTTGAGAGGTTCTGG + Intronic
955524882 3:59809799-59809821 AGGTTCTCCTTGGCAGCTTCGGG - Intronic
964413486 3:156423669-156423691 ATGTTCAGCTTTGCAAGTTCAGG + Intronic
966613272 3:181889239-181889261 AAGCTCCGCTTCCCAGGTTCAGG + Intergenic
968064721 3:195752320-195752342 AGGGGGCGCTTGGCGGGTTCAGG - Intronic
968979448 4:3838874-3838896 AGTTTCCCCCTCGCAGGTTCAGG + Intergenic
974019215 4:56678103-56678125 AGGATTCGCTTGGAAGGTGCTGG + Intronic
974429482 4:61777249-61777271 AAGCTCCGCCTCGCAGGTTCAGG - Intronic
978943973 4:114472359-114472381 ATGTTCTGTTTGGCAGGTTCCGG - Intergenic
989024552 5:37051812-37051834 TTGTTCCGCATAGCAGGTTCTGG - Exonic
990551816 5:56889248-56889270 AGCCTCCGCTTCCCAGGTTCAGG + Intronic
991953978 5:71973772-71973794 AGTTTCTGTTTGGCAGGTGCAGG - Intergenic
994720212 5:103371807-103371829 AGGCTCCTCTTGGCAGGATGGGG + Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998335082 5:141364558-141364580 AGCTGCCGCTTCGCGGGTTCAGG - Exonic
1001433795 5:171683844-171683866 ATGTTCAGCTTGGCATGTTCAGG - Intergenic
1001925176 5:175630961-175630983 AGTTTCCACCTGGCAGGTTTAGG + Intergenic
1002764005 6:224378-224400 AGGGTCTGCTGGGCAGGGTCAGG - Intergenic
1004956322 6:20731762-20731784 AGGTTCAGTTTGGCAGGTTCAGG + Intronic
1005379090 6:25215780-25215802 AAGTTCCGCCTCCCAGGTTCCGG - Intergenic
1005641222 6:27798353-27798375 AGGCTCTGCTTAGCATGTTCTGG - Intergenic
1006372217 6:33652137-33652159 AGGTTCCTCCTGGCAGGGGCAGG - Intronic
1006645642 6:35512531-35512553 AGGTCCCCCTTAGCAGGGTCTGG - Intronic
1024235337 7:47393491-47393513 AGATTCCGTGTGGCGGGTTCTGG + Intronic
1024482857 7:49883210-49883232 AGGTTCCGCTTGGCAGGTTCGGG - Intronic
1025924446 7:65945528-65945550 AAGTTCCGCCTCCCAGGTTCAGG - Intronic
1034589553 7:152128222-152128244 AGGCGCCCCTGGGCAGGTTCTGG - Intergenic
1037547651 8:19939816-19939838 AGGCTCCGCCGGGGAGGTTCCGG + Intronic
1037843743 8:22264175-22264197 AGGTGCCTCTTGGGAGGTTTTGG + Intergenic
1041118213 8:54560967-54560989 AGGTGCCACTTTGCAGGCTCAGG + Intergenic
1045319259 8:101069535-101069557 AGGATCTGCCTGGCAGGATCTGG + Intergenic
1050081108 9:1916881-1916903 AGCTTTCGCTTGGCAGGGTTTGG - Intergenic
1050601129 9:7252790-7252812 AAGTTCCGCCTCCCAGGTTCAGG + Intergenic
1056941682 9:90961584-90961606 AGCACCCGCTTTGCAGGTTCTGG + Intergenic
1058472746 9:105297912-105297934 AGGTTCCTCTGAGAAGGTTCAGG - Intronic
1058917127 9:109578503-109578525 AGTTTCCACTAGCCAGGTTCAGG - Intergenic
1061394203 9:130334367-130334389 AGGCTCTGCTGGGCAGGTCCTGG + Intronic
1188569813 X:31570720-31570742 AGATTCCTTTTGGTAGGTTCTGG + Intronic
1200214621 X:154362211-154362233 AGGTACCCCATGGCAGGTTGCGG - Intronic