ID: 1024484387

View in Genome Browser
Species Human (GRCh38)
Location 7:49900682-49900704
Sequence GAAGCACCGTGGACCCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024484384_1024484387 -10 Left 1024484384 7:49900669-49900691 CCTTCCAAAACAGGAAGCACCGT 0: 1
1: 0
2: 3
3: 51
4: 220
Right 1024484387 7:49900682-49900704 GAAGCACCGTGGACCCAGATAGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024484387 Original CRISPR GAAGCACCGTGGACCCAGAT AGG Intronic
900389652 1:2428409-2428431 GAGCCACCGTGGTCCCAGAGTGG - Intronic
900683346 1:3931204-3931226 GAAGCACCTTGGACACTGTTTGG - Intergenic
903226972 1:21899342-21899364 GAAGGACCTTGGACCCAGAAAGG + Intronic
904002215 1:27345297-27345319 GAAGCTCCGTGTGCCCAGCTGGG + Exonic
906843839 1:49168762-49168784 GAAGCCCCATGGATCCAGTTAGG - Intronic
916259682 1:162829135-162829157 GAAGAACCGCTGACCCAGAATGG + Intronic
1068411711 10:56663918-56663940 GAAGCATCCTGGGCACAGATAGG - Intergenic
1069783813 10:70975248-70975270 GAAGAAGGCTGGACCCAGATTGG + Intergenic
1077057004 11:598682-598704 GAGGCAGCGTGGTCGCAGATCGG - Intronic
1083680391 11:64349031-64349053 GAAGAACCGTGGGCTCAGAGAGG + Intronic
1092103442 12:5904221-5904243 CAAGGACCATGGTCCCAGATGGG - Intronic
1093708054 12:22297022-22297044 GGAGCACCGTGGGCCATGATTGG - Intronic
1102030405 12:109736995-109737017 GTAGCACCGTGAACCCATAGAGG + Intronic
1102540826 12:113617950-113617972 GAAGCCCCGTGGTCCCTGAAAGG + Intergenic
1103239247 12:119399277-119399299 GATGCACCCAGGACCCAGATGGG + Intronic
1103928582 12:124437231-124437253 GAAGAAGCGCGGACTCAGATGGG - Intronic
1104815647 12:131644141-131644163 GCAGCACCATGAACACAGATGGG + Intergenic
1106123192 13:26878894-26878916 GAAGCAAGGTGGACTCAGTTAGG + Intergenic
1109095418 13:58107821-58107843 GAACAACTGTGCACCCAGATTGG - Intergenic
1113887758 13:113669981-113670003 AATGCACCCTGGACCCACATCGG + Intronic
1115955330 14:38772217-38772239 AAAGCACAGTTGACACAGATCGG - Intergenic
1118616132 14:67575624-67575646 GAAGCACCAGAGACCCAGACAGG - Intronic
1118636677 14:67754417-67754439 GGTGCACTGTGGAACCAGATAGG + Intronic
1118875994 14:69785259-69785281 GAAGCACTGTGGTCACAGACAGG - Intronic
1122826757 14:104374383-104374405 GGAGGACCCCGGACCCAGATCGG + Intergenic
1128881297 15:71245586-71245608 GAATCACAGTGGAGCCACATAGG + Intronic
1132302460 15:100784424-100784446 GGAGCAGCGGGGAGCCAGATGGG + Intergenic
1132858999 16:2060838-2060860 GGAGCACCGGGAACCCAGACAGG + Intronic
1133949903 16:10382531-10382553 GAAGCACAGTGGACTCAGCTGGG + Intronic
1134228183 16:12408332-12408354 GCACCACAGTGGACCCAGAGAGG - Intronic
1141111784 16:81276043-81276065 GAAGCACTGTGGACCTGGAAGGG + Intronic
1142867699 17:2800666-2800688 GAAGCACCATGGACTCGGACTGG - Intronic
1147968832 17:44208773-44208795 GAGGTCCCGTGGTCCCAGATGGG + Intronic
1151914446 17:77107143-77107165 CAACCACCGTGGACCCACAGGGG + Intronic
1152784605 17:82241269-82241291 GAGGCACAGGGGACCCAGAAAGG + Intronic
1158556261 18:58477203-58477225 GAAGCGCCGTGGATCCAGCTGGG - Intergenic
1163453329 19:17391773-17391795 AAGGCACAGGGGACCCAGATGGG - Intergenic
925969913 2:9098965-9098987 GAGGCTCCGTGGTCCCAGACCGG + Intergenic
927511619 2:23647620-23647642 GCAGCACCGTAGAGCCAGACTGG - Intronic
927854753 2:26521053-26521075 GAAGTCCGGTGGACCCAGTTTGG - Intronic
928242139 2:29595887-29595909 GAAGAACCCTGGACACTGATAGG + Intronic
937257602 2:120566044-120566066 GAAGATCCTTGGGCCCAGATGGG - Intergenic
943859485 2:192842615-192842637 GAAGCACAGTGGATGGAGATAGG + Intergenic
947720261 2:232365727-232365749 GACGCAGCATGGCCCCAGATCGG - Intergenic
948423683 2:237875337-237875359 GAAGCAGCATGGACTCAGGTGGG + Intronic
1171215037 20:23346156-23346178 GAACCACCGTGGTCCTAGGTTGG - Intergenic
1184243873 22:43226309-43226331 GAAGCACAGGGGGCCCAGATGGG + Intronic
1185034504 22:48464947-48464969 GAAGGACCGGGGACCCTGAGAGG + Intergenic
954870456 3:53763726-53763748 GGATCAGCATGGACCCAGATAGG - Intronic
968669735 4:1842689-1842711 GATGCAGCGTGGACCGAGATGGG - Intronic
972159339 4:36203748-36203770 GAAGCACCGTAGGCTCTGATGGG - Intronic
977648627 4:99443284-99443306 GAAGAATAGTGGTCCCAGATAGG - Intergenic
985913303 5:2899198-2899220 TTCCCACCGTGGACCCAGATGGG + Intergenic
990310364 5:54531977-54531999 GAACCACAGTGCACTCAGATAGG + Intronic
1002719165 5:181247277-181247299 GAAGAACGGTGGACCCAGTCAGG - Intronic
1013179238 6:107704334-107704356 GAAGCACGCTCTACCCAGATGGG - Intronic
1013848680 6:114486413-114486435 GAAGCACTGTGAATCCACATAGG - Intergenic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1017621713 6:156306311-156306333 GAAGCAGCATAGAACCAGATTGG + Intergenic
1023998130 7:45174474-45174496 GAAGGAGCGTGGAGCAAGATGGG - Intronic
1024099988 7:46021365-46021387 GAAGCAGCTTGAACCCAGAAGGG + Intergenic
1024484387 7:49900682-49900704 GAAGCACCGTGGACCCAGATAGG + Intronic
1031554689 7:123158942-123158964 GAAGGACCATGACCCCAGATAGG + Intronic
1033249877 7:139749279-139749301 CCAGCACAGTGGACCCAGAAAGG + Intronic
1037814009 8:22102496-22102518 GAATCACAGGGGACTCAGATGGG - Intronic
1048060242 8:130912022-130912044 GAAGCACCATGGTCCCAGAGAGG - Intronic
1048895180 8:138985903-138985925 GAAGCAAGCTGGACCAAGATTGG + Intergenic
1049175646 8:141190858-141190880 GACTCTCCGTGGACCCAGACTGG + Intronic
1053197971 9:36135012-36135034 GAAACATGGTGGTCCCAGATGGG + Intergenic
1061505205 9:131027917-131027939 ACAGCAACGTGGACACAGATAGG - Intronic
1186510313 X:10125507-10125529 TGAGCTCCGTGGCCCCAGATGGG + Intronic