ID: 1024489744

View in Genome Browser
Species Human (GRCh38)
Location 7:49966857-49966879
Sequence TGGGAATTTACACCATTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024489744_1024489746 -10 Left 1024489744 7:49966857-49966879 CCATCTAATGGTGTAAATTCCCA 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1024489746 7:49966870-49966892 TAAATTCCCATGGCATACACAGG 0: 1
1: 1
2: 0
3: 13
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024489744 Original CRISPR TGGGAATTTACACCATTAGA TGG (reversed) Intronic
903112654 1:21149978-21150000 TTGGAATTTACAGCATTAGTGGG - Intronic
908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG + Intergenic
916946843 1:169737827-169737849 TGGGAACTTCCATCTTTAGAGGG - Intronic
922299936 1:224290003-224290025 TAAGAATTTACAACATTACAGGG + Intronic
923447369 1:234084861-234084883 TGGGATTCTTCACTATTAGAAGG + Intronic
1065193767 10:23240815-23240837 TGGGAAGTCACTTCATTAGATGG - Intergenic
1081398823 11:42618607-42618629 AGGGAATTTAGACCATTTGTAGG - Intergenic
1081733407 11:45387183-45387205 TGGGAATTTTAACCATTTGATGG + Intergenic
1086345562 11:85892212-85892234 TGGGAAGGGACGCCATTAGATGG + Intronic
1086350724 11:85941325-85941347 TAGGAATCTACACCATAAAAAGG + Intergenic
1091298011 11:134487172-134487194 TGGGATTCTCCTCCATTAGATGG + Intergenic
1093363570 12:18263380-18263402 TTGGAATTTATACCTTTATAAGG - Intronic
1093678312 12:21970133-21970155 TGGGAAATGACACAATTATATGG + Intergenic
1097602886 12:61716179-61716201 TGGGAATTTAATACATTGGATGG - Intronic
1100073638 12:90752617-90752639 TGGAAATTTATAGCATTAAATGG - Intergenic
1107598445 13:41987960-41987982 TGAGAATTTACACCAGATGAAGG - Intergenic
1111567837 13:90039997-90040019 TAGGAATTTAAACCATAATATGG - Intergenic
1111849254 13:93551631-93551653 TGGCAATTTCCAACATTAGTGGG + Intronic
1114937717 14:27564306-27564328 TGAGAATTTTCACCATGAAAGGG - Intergenic
1115355170 14:32439272-32439294 TGGGATTTGGCACCATCAGATGG + Intronic
1115763785 14:36602004-36602026 TGAGCATTTTCACAATTAGAAGG - Intergenic
1119706166 14:76783847-76783869 TGGGACTGTACACCAGTAAACGG + Intergenic
1120290064 14:82556862-82556884 TGGAAATTTAAACCAATAGGAGG - Intergenic
1121302440 14:92882066-92882088 TGGGAATTTTCCCCAGTACAAGG - Intergenic
1125828765 15:42696517-42696539 TGGGAAGTAACACAATGAGATGG - Intronic
1126811746 15:52413340-52413362 TGGAAATTTTCATCATAAGATGG - Intronic
1131049615 15:89337869-89337891 TGGGCATTTACAGCAGTGGAAGG - Intergenic
1132221463 15:100108544-100108566 TGGGACTATATACCAGTAGATGG + Intronic
1132329396 15:101001221-101001243 TGGGAACTCAGACCATCAGACGG - Intronic
1149133207 17:53333245-53333267 TGGGAATTGTCACCATTAGTTGG - Intergenic
1149875993 17:60233850-60233872 TGGGAATTTATTCAATAAGATGG - Intronic
1150817508 17:68404442-68404464 ATGGAATTCACACCATTAAAAGG - Intronic
1150864285 17:68833380-68833402 TGGGAACTTTCACCATTGGAAGG - Intergenic
1152287069 17:79419051-79419073 TGCTAATTTACAGCATTAGGAGG - Intronic
1153419094 18:4884392-4884414 TGGGTCTTTGCACCATGAGAGGG + Intergenic
1156972296 18:43170953-43170975 TGGGAATTCACACCATTTGCTGG + Intergenic
1157493271 18:48138444-48138466 TGGGTATTTACAGTTTTAGAGGG - Intronic
1158837309 18:61344624-61344646 TGGTAATTTGCACTATTTGAAGG - Intronic
1159941927 18:74414912-74414934 AGGGAATTTTCACCAATAGCAGG - Intergenic
1161383846 19:3980662-3980684 TGGAAATATACATCATAAGAGGG + Exonic
1164386075 19:27771440-27771462 TGGGAGTCTCCACCATTAGGAGG + Intergenic
1166330319 19:42074691-42074713 AGGGAATTTAATCCATGAGAAGG + Intronic
927480297 2:23448496-23448518 TGGGAGTTTCCAGAATTAGAAGG + Intronic
928321388 2:30285211-30285233 GGGATATTTACACCATTTGAAGG + Intronic
928859765 2:35843192-35843214 TGTAAAGTTTCACCATTAGATGG + Intergenic
929310911 2:40423107-40423129 TGGGATTTTAAATCATTATAAGG - Intronic
929973336 2:46605721-46605743 TTGGAATCTAGATCATTAGATGG - Intronic
931322164 2:61181829-61181851 TGAGACTTTTCACCATTAAAGGG - Intronic
931804727 2:65793179-65793201 TCTGAATTTACACCATTGGTGGG + Intergenic
932838789 2:75061775-75061797 TGGGAATTGACTCCACCAGAAGG - Intronic
932863618 2:75319158-75319180 TGAGAATTTGCATCATCAGAGGG + Intergenic
932939470 2:76145666-76145688 TGAGAATTTAAATCTTTAGAAGG + Intergenic
933578815 2:84101643-84101665 TTGGACTTGACACCATTAGAAGG - Intergenic
935454778 2:103254645-103254667 GGGAAATTCACACCATTACATGG + Intergenic
936399394 2:112154296-112154318 TGAAAATTTATACCATTTGAGGG + Intronic
937797312 2:126039133-126039155 AGGGAATATACACTATTACAAGG - Intergenic
938181079 2:129184218-129184240 TTGGAATTTAAAACATTAGCGGG - Intergenic
940025443 2:149202212-149202234 TGGCATTTTTCACAATTAGATGG + Intronic
944251392 2:197582817-197582839 TGGGATTTGACACCTTTTGATGG - Intronic
1170258171 20:14370532-14370554 TGGGAATTTCATCCTTTAGATGG - Intronic
1170535520 20:17337133-17337155 TCGCAATTCACACCATTGGAAGG + Intronic
1171061686 20:21970272-21970294 TGGGACTTCACATCATTGGAAGG + Intergenic
953134655 3:40172176-40172198 TGGCATGTTTCACCATTAGATGG - Intronic
956431394 3:69189985-69190007 TGTGCATTTATACAATTAGAGGG + Intronic
956443655 3:69304725-69304747 TGGGAATTTACAGCCTAAAATGG - Intronic
956973131 3:74550215-74550237 TGGAAATTTTCACCATGAGCAGG + Intergenic
957627940 3:82678910-82678932 AGGGAATTGACATCATTAGGGGG + Intergenic
959162598 3:102739275-102739297 TGGTAATTTACACCTATAGCTGG + Intergenic
960150395 3:114243357-114243379 TGGGATATTACAGCATGAGATGG - Intergenic
964786902 3:160406442-160406464 TGGCAATTTAAAGCATTTGATGG + Intronic
974402715 4:61426246-61426268 TGGCAATCTGCACCAATAGATGG - Intronic
977375455 4:96197411-96197433 TAGGAATTGACACCATCAGAGGG - Intergenic
978505098 4:109448262-109448284 TGGCAAGGTAAACCATTAGAAGG + Intronic
978956534 4:114620855-114620877 TGGGAATTTATACAAATAGGAGG + Intronic
979603484 4:122611951-122611973 TGGCAATTTAAACCTATAGAGGG - Intergenic
980718424 4:136659654-136659676 TCAGAATTTGCACCATTAGGTGG + Intergenic
981121222 4:141052906-141052928 TGGCAATTTCCACCATTTGGTGG + Intronic
982076835 4:151746145-151746167 TGGGAACTGACACCAGGAGAGGG + Intronic
982855442 4:160376407-160376429 TGGTAATTTAGAACTTTAGAGGG - Intergenic
983207978 4:164931143-164931165 TGGGAATTTGCTCCATTGGCAGG + Intergenic
983210870 4:164956501-164956523 TGGGAATTTACTCCATTGGCAGG - Intronic
986396573 5:7336394-7336416 TTGGAATTGACACCAATAGGAGG - Intergenic
993003395 5:82405417-82405439 GGGCAATTTCCACCTTTAGAAGG - Intergenic
1001013906 5:168123510-168123532 TGAGAATTTAAACCATAAGACGG + Intronic
1001708983 5:173762729-173762751 TGGCAAATGGCACCATTAGAGGG - Intergenic
1003728545 6:8793729-8793751 TGGGAACTTAATCCAGTAGACGG + Intergenic
1005765741 6:29010296-29010318 TGGGAAATTACCCTTTTAGAAGG - Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1008840161 6:55893276-55893298 TGGGAATTTAAACCATGGGCAGG - Intergenic
1010969221 6:82246781-82246803 TGTGAATTTACACCACTTTATGG + Intronic
1012058724 6:94449535-94449557 GGTGAACTTACACCATTATATGG - Intergenic
1012633694 6:101508023-101508045 AGGAAATTTAGACAATTAGATGG + Intronic
1022226970 7:28373150-28373172 TCTGAATTTACTCCATGAGAGGG - Intronic
1024489744 7:49966857-49966879 TGGGAATTTACACCATTAGATGG - Intronic
1030315598 7:108110951-108110973 AGAGATTTTAGACCATTAGAAGG - Intronic
1032892288 7:136210404-136210426 TGGGAATTTAAAACTTAAGAAGG + Intergenic
1037745668 8:21642214-21642236 GGGGAATTTACACCCCGAGAAGG - Intergenic
1043036391 8:75205458-75205480 TGGGAATTTATAGCACTAAATGG - Intergenic
1045512783 8:102826054-102826076 TGGGCATTAATACCATTAAATGG - Intergenic
1045724816 8:105159880-105159902 TGGGTCTTGACTCCATTAGAAGG - Intronic
1045857502 8:106781181-106781203 TGGGAATTGTCATCATAAGATGG - Intergenic
1047641209 8:126823683-126823705 TGGTAATTAACACCATGATATGG + Intergenic
1050309017 9:4334215-4334237 CTGGAATTTACACTATCAGATGG - Intronic
1050311518 9:4357918-4357940 CGCAAATTTCCACCATTAGAGGG + Intergenic
1051906183 9:22097170-22097192 TGGTAATTTACAGCATGAGATGG + Intergenic
1055166419 9:73200862-73200884 AGGTAATTTTCACCACTAGATGG + Intergenic
1059044606 9:110852610-110852632 TTGGAATTTACATTTTTAGAAGG - Intergenic
1060372943 9:123091836-123091858 TGGGAATTTGCACCGTAAGGAGG - Intronic
1061159965 9:128888059-128888081 TGGGCATTTACAGCAGCAGAGGG + Intronic
1190926108 X:54906446-54906468 TGGGATTTTACATCATAACAGGG + Intergenic
1191183940 X:57590885-57590907 TGGGAATTGACACAAATATAGGG - Intergenic
1191800037 X:65068022-65068044 TTGGAAATTACACAAATAGATGG - Intergenic
1192414507 X:70966614-70966636 TGGGTACAAACACCATTAGAAGG + Intergenic
1194319467 X:92425663-92425685 TGGGGTTTTAAACCATAAGAAGG + Intronic
1194421214 X:93674563-93674585 TAGAATTTTACAACATTAGAAGG - Intronic
1195058949 X:101175345-101175367 TGGATATTTACCCCATTATAAGG + Intergenic
1200627594 Y:5538739-5538761 TGGGGTTTTAAACCATAAGAAGG + Intronic