ID: 1024491789

View in Genome Browser
Species Human (GRCh38)
Location 7:49994252-49994274
Sequence TATGCAGGACCACCCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024491789_1024491791 3 Left 1024491789 7:49994252-49994274 CCACTTTTGGGTGGTCCTGCATA 0: 1
1: 0
2: 2
3: 5
4: 113
Right 1024491791 7:49994278-49994300 TTGAGAACCATCTGTAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024491789 Original CRISPR TATGCAGGACCACCCAAAAG TGG (reversed) Intronic
903845400 1:26276957-26276979 CATGCAGGACAAACTAAAAGTGG + Intronic
904435480 1:30492232-30492254 TGTGCTGGACCACGCAGAAGGGG - Intergenic
906001610 1:42431196-42431218 TCTCCAGGACCACCCCAGAGTGG - Intronic
912354460 1:109043186-109043208 TGAGCTGGACCTCCCAAAAGGGG + Intergenic
915069514 1:153254631-153254653 GCTCCAGGAGCACCCAAAAGAGG + Intergenic
916705788 1:167348366-167348388 TTTGAAGGACCATCAAAAAGTGG - Intronic
917210951 1:172631710-172631732 TATGCAGGAACACAGAAGAGTGG + Intergenic
922714515 1:227859943-227859965 TCTGCAGGACCTCCCCCAAGGGG - Intergenic
924491893 1:244545984-244546006 TATGCAGCAGCACCAAAAAGTGG + Intronic
1065771116 10:29079629-29079651 TATGCAGGACTGACAAAAAGAGG - Intergenic
1068520273 10:58069892-58069914 TATCCAGGCCATCCCAAAAGTGG - Intergenic
1071334855 10:84592000-84592022 TATGGAGCACCTCCCAAGAGTGG - Intergenic
1077446577 11:2594017-2594039 TATGCAGCATCAACAAAAAGAGG - Intronic
1077965935 11:7133533-7133555 TATGCAGGACCTCAAGAAAGGGG + Intergenic
1078386346 11:10896377-10896399 TCTGCAGGACTACCCTGAAGGGG - Intergenic
1084912000 11:72397296-72397318 TATTCATGACCACCAAAAACTGG - Intronic
1085400506 11:76232963-76232985 TATGCAGGACCACCCTAGGGGGG - Intergenic
1091785157 12:3238937-3238959 CATGCAGGCCCTCCCAAAGGAGG + Intronic
1100127836 12:91452193-91452215 TATGTAGGAACACCTACAAGGGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1107831120 13:44374228-44374250 TCTGCAGGACCCCGCAGAAGGGG - Intronic
1109392360 13:61709365-61709387 TATGCAGCACCACATAATAGTGG + Intergenic
1113546549 13:111155235-111155257 TATGTAGGATAACCCAACAGAGG + Intronic
1113725599 13:112598356-112598378 TAGGCAGGAACACACAACAGTGG + Intergenic
1114351332 14:21854904-21854926 TCTGCAGTACCACGCAAAAATGG - Intergenic
1116252065 14:42499058-42499080 TATGAAGGAACACCCAACACTGG - Intergenic
1119189228 14:72669020-72669042 TAGACAGAACAACCCAAAAGTGG + Intronic
1121613517 14:95297260-95297282 TAAGCAGGACTGCACAAAAGTGG - Intronic
1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG + Intergenic
1126971007 15:54111759-54111781 TAAGCAGGACCACTCCAAGGGGG + Intronic
1128548284 15:68581724-68581746 TATGAAGGAGAACCCTAAAGAGG + Intronic
1129554455 15:76491346-76491368 TATGCATAATCACCCAAAACTGG - Intronic
1131773320 15:95765109-95765131 TATGAAGAAACACCCAAAACTGG + Intergenic
1143874122 17:9979062-9979084 TAGGCAAAACCACCCAAAAGAGG + Intronic
1144413523 17:15023904-15023926 TATGCAGGGGCACCCAAAAGGGG - Intergenic
1144522984 17:15966749-15966771 TTTGCAGGCCCACACAACAGGGG - Intronic
1147522544 17:41188322-41188344 TATGCTGGACCAGCAAACAGAGG + Intergenic
1151230683 17:72682996-72683018 TTTGCAGGAGGACTCAAAAGAGG - Intronic
1154181971 18:12145922-12145944 TTTGTAGGACCTCCCAAATGGGG + Intergenic
1155785227 18:29888876-29888898 TATGTAGGACCATCCACAAAAGG - Intergenic
1159931705 18:74318989-74319011 AATGAAGGACACCCCAAAAGTGG - Intronic
1163294062 19:16400934-16400956 TGAGCAGGACAAGCCAAAAGCGG + Intronic
1166911754 19:46163985-46164007 TGGGCAGGACCTCCCAAATGGGG - Intergenic
1168672457 19:58250990-58251012 TATACAGGACCACGCATAATGGG - Intronic
1202636503 1_KI270706v1_random:48683-48705 TGTACAGGACCTCCCAAATGGGG - Intergenic
929994678 2:46817853-46817875 AATGCAGGACCTCCCAAGAATGG + Intronic
932806747 2:74791107-74791129 TATGGAGGACCACCTGAAACAGG - Intergenic
933229175 2:79786022-79786044 TATGCAAGACCACCCTTAACAGG - Intronic
938041211 2:128077776-128077798 TATGCAGGAGCACACGCAAGGGG + Intergenic
938757316 2:134392834-134392856 TATGCTGTCCCACCCAGAAGGGG + Intronic
947408647 2:229809698-229809720 TCTTCAGGACCACTCAAAATAGG + Intronic
1169437023 20:5601812-5601834 AATGCAGGAGCACCTATAAGAGG - Intronic
1179516747 21:41913812-41913834 GATTCAGAACCACCCAGAAGGGG + Intronic
1180133493 21:45844259-45844281 TGTGCAAGACCTCCCTAAAGTGG - Intronic
1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG + Intergenic
1180855050 22:19040375-19040397 TAGGCAGTGCCACCCCAAAGTGG - Intronic
949325813 3:2862997-2863019 TAGGCTGGAGCACCAAAAAGGGG - Intronic
949603185 3:5623709-5623731 TATTCATAACCACCCAAAACTGG - Intergenic
950226449 3:11238940-11238962 TATTCATAACCACCAAAAAGTGG - Intronic
950240451 3:11365318-11365340 CATGCAGGGTCACCAAAAAGTGG + Intronic
951384575 3:22027899-22027921 TATGCAGGCACTACCAAAAGTGG + Intronic
953643566 3:44731678-44731700 AATGCAGGACCACACAGAAATGG + Intronic
956534588 3:70261643-70261665 AGTGCAGGACCAGCCAAAACTGG + Intergenic
957298456 3:78361272-78361294 TATGCAGGCACCACCAAAAGTGG - Intergenic
959676825 3:109045185-109045207 GATGCAGAACCACCTGAAAGTGG - Intronic
966340841 3:178923807-178923829 TGGGCAGGACCTCCCAAATGGGG + Intergenic
967730653 3:192903839-192903861 AATGCAGGAGCAAGCAAAAGTGG - Intronic
973394296 4:49580383-49580405 TGTACAGGACCTCCCAAATGGGG + Intergenic
978758557 4:112330455-112330477 TATGCACTACCACCCAAAGAGGG + Intronic
983898964 4:173113054-173113076 TGGGCAGGACCTCCCAAATGGGG + Intergenic
1202763819 4_GL000008v2_random:134553-134575 TGTACAGGACCTCCCAAATGGGG - Intergenic
987478597 5:18424433-18424455 TATGCAGAACTACCCAAGACAGG + Intergenic
991157708 5:63458641-63458663 TGGGCAGGACCTCCCAAATGGGG + Intergenic
991495113 5:67218991-67219013 AATGCAGGACCAGCCCAAACTGG + Intergenic
994124337 5:96152576-96152598 TATGCAGAACCAACCCAAGGAGG + Intergenic
997022151 5:130014345-130014367 TATGAAGAAATACCCAAAAGTGG + Intronic
997694326 5:135849623-135849645 TATGTAGGACCACCCAACTAGGG - Intronic
998033133 5:138890507-138890529 TAATCAGGACCAGCCAAATGAGG + Intronic
998515480 5:142749953-142749975 TAGTCAGGACTACCCAAGAGGGG - Intergenic
1001593611 5:172883576-172883598 TAGGCAGGATCCCCCAGAAGTGG + Intronic
1003492948 6:6639810-6639832 TGTGCAGGACCCCCCAAAAGTGG - Intronic
1008625057 6:53307244-53307266 TAACCACTACCACCCAAAAGTGG - Intronic
1012367922 6:98464854-98464876 TATTCAGGATCACCAGAAAGGGG + Intergenic
1015687320 6:135879510-135879532 TCTGCAGGACCTACAAAAAGTGG + Intronic
1017622282 6:156311180-156311202 TATGAAGGAGAACCCAGAAGAGG + Intergenic
1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG + Intergenic
1021786132 7:24154591-24154613 TATGCTGGACCATGCTAAAGTGG + Intergenic
1023241349 7:38151194-38151216 TATGCAAGACCACCCTGCAGAGG - Intergenic
1023559297 7:41456353-41456375 AATACAGCACCACCAAAAAGTGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024795261 7:53012459-53012481 TATGTAAGACCTCCCAACAGGGG - Intergenic
1024935074 7:54703369-54703391 TATGCTGGACAACCCAACAGGGG - Intergenic
1026252990 7:68687016-68687038 TAGGCAGGACCAGCCCAAACTGG + Intergenic
1028649161 7:93131296-93131318 TATTCAGGTCCACTCAGAAGTGG - Exonic
1028725272 7:94080018-94080040 TATGGAAGACCACTCAACAGAGG + Intergenic
1029405860 7:100373726-100373748 TACCCAGGACCACCCAGATGTGG + Intronic
1030207785 7:106967273-106967295 TCTCCAGGACCACAGAAAAGAGG + Intergenic
1031317247 7:120273268-120273290 GATGCAGGACCACCCACTGGCGG + Intergenic
1034411867 7:150946238-150946260 CATGCAGGTCCACCCAGGAGAGG + Intronic
1034492489 7:151401173-151401195 TAGGCAGGACGCCCCAAGAGGGG - Intronic
1034856370 7:154552053-154552075 TAAGCAGCAACACCCAAAATGGG - Intronic
1035914980 8:3609009-3609031 TATGCAGGACCGCTGGAAAGGGG - Intronic
1037012421 8:13859903-13859925 AAGGCAGGACAACTCAAAAGAGG - Intergenic
1039102585 8:33957268-33957290 TAGGCAGGGCCACCCAACATGGG - Intergenic
1042462986 8:69092412-69092434 TATGCATGGCCACACAAAAATGG - Intergenic
1042644289 8:70968888-70968910 TGTGTAAGACCTCCCAAAAGGGG - Intergenic
1043978624 8:86612446-86612468 TGGACAGGACCACCCACAAGAGG - Intronic
1048474135 8:134727978-134728000 GAGACAGGAGCACCCAAAAGTGG - Intergenic
1056436242 9:86578177-86578199 TGTACTGGACCACCCAAGAGCGG + Intergenic
1060558469 9:124522734-124522756 AATGCAGCACCACCTTAAAGAGG + Exonic
1203544571 Un_KI270743v1:119426-119448 TGTACAGGACCTCCCAAATGGGG - Intergenic
1193715143 X:84928092-84928114 TGGGCAGGACCTCCCAAATGGGG - Intergenic
1194188758 X:90808352-90808374 TATGTAGAACCTCCCAAATGGGG - Intergenic
1194947944 X:100091309-100091331 TGGGCAGGACCTCCCAACAGGGG + Intergenic
1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG + Intergenic
1195148637 X:102043569-102043591 TGGGCAGGACCACCCAACCGGGG + Intergenic
1196528758 X:116759035-116759057 TTTGCAGGACCTCCCAACTGGGG + Intergenic
1197504678 X:127287053-127287075 TATGCAGTACCACCTGAAGGTGG - Intergenic
1200535340 Y:4390249-4390271 TATGTAGAACCTCCCAAATGGGG - Intergenic
1201756750 Y:17494456-17494478 TGGGCAAGACCTCCCAAAAGGGG + Intergenic
1201844803 Y:18411528-18411550 TGGGCAAGACCTCCCAAAAGGGG - Intergenic