ID: 1024491791

View in Genome Browser
Species Human (GRCh38)
Location 7:49994278-49994300
Sequence TTGAGAACCATCTGTAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024491789_1024491791 3 Left 1024491789 7:49994252-49994274 CCACTTTTGGGTGGTCCTGCATA 0: 1
1: 0
2: 2
3: 5
4: 113
Right 1024491791 7:49994278-49994300 TTGAGAACCATCTGTAAACCAGG No data
1024491786_1024491791 14 Left 1024491786 7:49994241-49994263 CCAATAGCTGCCCACTTTTGGGT 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1024491791 7:49994278-49994300 TTGAGAACCATCTGTAAACCAGG No data
1024491788_1024491791 4 Left 1024491788 7:49994251-49994273 CCCACTTTTGGGTGGTCCTGCAT 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1024491791 7:49994278-49994300 TTGAGAACCATCTGTAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024491791 Original CRISPR TTGAGAACCATCTGTAAACC AGG Intronic
No off target data available for this crispr