ID: 1024493753

View in Genome Browser
Species Human (GRCh38)
Location 7:50017843-50017865
Sequence TAGGTACAGGATGCCGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024493746_1024493753 14 Left 1024493746 7:50017806-50017828 CCTTCTAGAAGATATAGCATCAT 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1024493753 7:50017843-50017865 TAGGTACAGGATGCCGGGTATGG 0: 1
1: 0
2: 0
3: 16
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024493753 Original CRISPR TAGGTACAGGATGCCGGGTA TGG Intronic
900980015 1:6040967-6040989 GAGGAACAGGATGCCGGGGTTGG - Intronic
903465938 1:23552872-23552894 TAGGTATAGGAGGCCGGGCGCGG + Intergenic
903663305 1:24991822-24991844 TAGGCACAGCATGCCAGGGAGGG - Intergenic
904411317 1:30326633-30326655 TAGGTATCGGATGCAGGGAAGGG - Intergenic
904526270 1:31136202-31136224 TGGGTACAGGATGGGGGGTGGGG - Intergenic
905504476 1:38466168-38466190 TAGGGACAAGAGGCCGGGCATGG - Intergenic
907489482 1:54800029-54800051 TAAGGACAGCATGCAGGGTAGGG - Intronic
909094533 1:71271006-71271028 TGGGTACAGGATGTGGGGCAGGG + Intergenic
909575358 1:77170040-77170062 TAGAAGCAGGATGCCAGGTAGGG - Intronic
909804673 1:79859186-79859208 TAGGTACAGGATAGGGGGCATGG + Intergenic
910465338 1:87493091-87493113 TGGGTACAGCATGCTGGGTGGGG + Intergenic
910478543 1:87634258-87634280 TAGGCACAGGATGGAGGGTGTGG + Intergenic
915927586 1:160035180-160035202 AAGGTGCAGGATGCTGGGCATGG - Intergenic
916900332 1:169215297-169215319 TAGGCACAGGATGGGGGGCAGGG + Intronic
917254912 1:173103870-173103892 TAGGCACAGGATGGGGGGTATGG + Intergenic
917539860 1:175901972-175901994 TGGGTACAGGATGGGGGGTGTGG - Intergenic
922191609 1:223323605-223323627 CAGGTACAGGATGCAGGGTGAGG + Intronic
923304986 1:232680219-232680241 TAGGTACAGGAGGCACGTTAAGG + Intergenic
923773721 1:236960000-236960022 TAGCAACAGGATGCTGAGTACGG + Intergenic
1064164433 10:12974183-12974205 TAGGAAAAGCCTGCCGGGTACGG + Intronic
1064680478 10:17806625-17806647 TGGGCACAGGATGCGGGGTGTGG + Intergenic
1064785236 10:18887792-18887814 CGGGTACAGGATGCAGGGCAGGG - Intergenic
1064791117 10:18958926-18958948 TAGATGCAGGATGCCTGGTGAGG + Intergenic
1064795861 10:19010259-19010281 TAGGCACAGGATGGGGGGCATGG + Intergenic
1065909282 10:30287294-30287316 TAGGCACAGGATGAGGGGTAGGG + Intergenic
1068712510 10:60149997-60150019 GTGGTATAGGAGGCCGGGTATGG - Intronic
1069247216 10:66220872-66220894 TAGGTACAGGATGGGGGGTGAGG + Intronic
1069501491 10:68956750-68956772 TGGGTACTGGAGGCCGGGTGCGG + Intronic
1070086610 10:73244203-73244225 AAGGAACATGAGGCCGGGTATGG + Exonic
1071152624 10:82652605-82652627 TAGGCAGAGGATGTCAGGTAGGG + Intronic
1072052569 10:91720988-91721010 TAGGTAGAGGATCACAGGTATGG - Intergenic
1081779970 11:45703443-45703465 TAGGGAGAGGATGCCTGGAATGG + Intergenic
1083624376 11:64064627-64064649 TTGGAACAGGATGCAGAGTAGGG + Intronic
1084150061 11:67283958-67283980 TAGGTACAAGAGGCCAGGCAAGG - Intronic
1087575611 11:99985467-99985489 TAGGCACAGGATGATGGGTAGGG + Intronic
1088797765 11:113278253-113278275 GAAGTACAGAATGCTGGGTAGGG - Exonic
1089416347 11:118295368-118295390 TGGCTGCAGGATGCCAGGTAAGG - Intergenic
1103287983 12:119818943-119818965 CAGGTACACGATGCCAGGCAAGG + Intronic
1107827926 13:44347134-44347156 TAGGTACAGTAGGCCAGGCATGG + Intergenic
1108248572 13:48542256-48542278 TAGGCACAGGATGGGGGGCAGGG - Intergenic
1109313986 13:60727968-60727990 TAGGCACAGGATGGAGGGTGGGG + Intergenic
1111364755 13:87227921-87227943 TAGTTACAGGAGGCTGGGAAGGG - Intergenic
1116712298 14:48383650-48383672 TAGGCACAGGATGGGGGGCAGGG + Intergenic
1120218408 14:81705186-81705208 TGGGTACAGGATGGCGGGTGTGG + Intergenic
1124930448 15:34114615-34114637 TAGGCACAGTATGGCGGGTGGGG - Intergenic
1128001807 15:64199952-64199974 TAGGCACAAGGTGCCGGGCATGG + Intronic
1128135853 15:65262922-65262944 TAGGTAGGGGGTGCCAGGTAAGG - Intronic
1129224618 15:74161496-74161518 TAGATACATGATGCCGGGCCAGG - Intergenic
1132688640 16:1172653-1172675 TGGCTACAGGAAGCCGGTTATGG - Intronic
1135064461 16:19297955-19297977 TATGTACAGGTGGCCGGGTGCGG + Intronic
1136502843 16:30682052-30682074 TACGTATAGGAGGCCGGGTGCGG + Intergenic
1137964109 16:52914074-52914096 TGGGTACAGGATGGGGGGTGTGG - Intergenic
1138270691 16:55693842-55693864 TTTGTACAGGATGCAGGGGAGGG + Intronic
1140231684 16:73122649-73122671 TAGGAACAGGATGCTAGGAAGGG - Intergenic
1140564567 16:76026797-76026819 TGGGTACAGGATGAGGGGTGGGG - Intergenic
1141103533 16:81215104-81215126 CAGGTCCAGGATGCCGTCTACGG - Intergenic
1142512998 17:409688-409710 AAGGTACAGGAGGCCGAGCACGG + Intergenic
1144300824 17:13921985-13922007 TAGGCACAGGATGCAGGGAGTGG - Intergenic
1146409159 17:32567101-32567123 AAGGTAGAGGATGCTGGGAAAGG + Intronic
1150802536 17:68292804-68292826 TTGGTACAGGGTGCCTTGTATGG + Intronic
1151512345 17:74568847-74568869 TATGTACAGTATGTGGGGTAGGG + Intergenic
1154218124 18:12430245-12430267 CAGATACAGGATGCCAGGCAAGG - Intronic
1155160031 18:23188106-23188128 CAGGTACAGGGAGCAGGGTAGGG - Intronic
1157139750 18:45094006-45094028 TAGGTACAAGAGGCCAGGTACGG + Intergenic
1158184782 18:54759671-54759693 TGGGTACAGGATGGTGGGGAGGG - Intronic
1158184900 18:54760370-54760392 TAGGTAGAGGATGTAGGGGAGGG + Intronic
1160892778 19:1387963-1387985 TAGGGACAGGATGCAGGTGACGG + Intronic
1163689901 19:18732798-18732820 TAACTACAGGAGGCCGGGTGTGG + Intronic
1167393721 19:49213279-49213301 AAAGTACTGGAGGCCGGGTACGG - Intergenic
1167507758 19:49880146-49880168 AAGGTACAGCAGGCCGGGTGCGG - Intronic
925705745 2:6683372-6683394 TGGGTACAGGATGGGGGGTGGGG + Intergenic
926562744 2:14435313-14435335 TAGGCACAGGATGGGGGGTGGGG + Intergenic
927041303 2:19233091-19233113 TAGGAACAGGAGGTCGGGTGTGG - Intergenic
929906953 2:46054792-46054814 TAGGCACAGGATGGGGGGTGGGG - Intronic
932932297 2:76056591-76056613 TAAGTTCAGGAGGCCGGGTGTGG - Intergenic
933846231 2:86329231-86329253 TGGATACAGGATGCGGGGTGTGG + Intronic
933875436 2:86616027-86616049 TTGGTACAGGTTGCTGGGGAAGG - Intronic
937770951 2:125720720-125720742 TAGGCACAGGATGGTGGGGATGG - Intergenic
938150735 2:128880177-128880199 TAGGCACAGGATGGGGGGTGGGG + Intergenic
943690195 2:190861719-190861741 TAGGAAAAGGATGCTGGGCACGG + Intergenic
944512348 2:200477085-200477107 TGGGTACAGGATACGGGGTGGGG + Intronic
946221612 2:218232492-218232514 TTGCTACAGGATGACGGGAAAGG - Intronic
947905839 2:233761431-233761453 TAGGCACAGAATGCTGGGTTTGG + Intronic
1169087397 20:2835977-2835999 TAGGCATAGGAGGCTGGGTAAGG + Intronic
1170067194 20:12325893-12325915 TAGTTACAGGAGGCCGGGCGCGG + Intergenic
1174055037 20:47792782-47792804 AATGTACAGGCTGCTGGGTATGG - Intergenic
1177380961 21:20343940-20343962 TAGTTAAAGGATGCCGGGTGTGG + Intergenic
1177564166 21:22796522-22796544 TAGGCACAGGATGCAGGGAGTGG + Intergenic
1177801553 21:25833549-25833571 TAGGCACAGGATGGGGGGTGGGG - Intergenic
1177962114 21:27680113-27680135 TAGGCACAGGATGTGGGGCAGGG + Intergenic
1178904881 21:36628457-36628479 TGGGCACAGGATGCTGGGTAGGG - Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1180674198 22:17576061-17576083 AAGGTAGAGGAGGCCGGGCATGG + Intronic
1185101608 22:48843648-48843670 TGGGTACAGAATGCAGGGTGTGG + Intronic
1185234600 22:49704736-49704758 TAGGTACTGGAGGCCAGATAAGG + Intergenic
950518704 3:13483562-13483584 AAGGTACAGGATGTCGGGCCTGG + Exonic
950758293 3:15196548-15196570 TATGTCCAGGATGCATGGTAGGG + Intergenic
951543391 3:23804521-23804543 TAGATACAGGTTTCCTGGTAGGG + Intergenic
955677361 3:61462876-61462898 TAGGGACAAGAGGCCGGGTGCGG + Intergenic
956982408 3:74654327-74654349 TGGGTACAGGATGGGGGGCATGG - Intergenic
957758361 3:84522550-84522572 TAGGCACAGGATGGGGGGCATGG - Intergenic
959694150 3:109231688-109231710 TGGGTACAGGATGCGGGGTGGGG - Intergenic
965065207 3:163839477-163839499 TAGGCACAGGATGAAGGGTGTGG + Intergenic
965085287 3:164088535-164088557 TGGGTACAGGATGGGGGGTGTGG - Intergenic
970144789 4:13024002-13024024 GAGGTGCAGGATGCCTGGTGTGG + Intergenic
971336261 4:25726631-25726653 GAGTTACACGATGCCGGGAACGG + Intergenic
971749703 4:30631697-30631719 TAGGTACAGGATGGAGGATGGGG - Intergenic
973068047 4:45821904-45821926 TGGGTACAGGATGGGGGGTGTGG + Intergenic
974505871 4:62771746-62771768 TGGGTACAGGATGGGGGGTGGGG - Intergenic
974907908 4:68079966-68079988 TAGTTACTGTATGCCAGGTAGGG + Intronic
975247016 4:72131140-72131162 TAGGTATAGGATGCGGGGCGTGG + Intronic
975580876 4:75906150-75906172 TGGGTACAGGATGTGGGGTGTGG - Intergenic
978327366 4:107574863-107574885 TAGGCACAGGATGGAGGGCATGG - Intergenic
979771025 4:124525197-124525219 TAGGTACAGGATAGGGGGTGTGG - Intergenic
983172564 4:164552302-164552324 TAGGCACAGGATGCGGGGGGTGG + Intergenic
984229362 4:177075469-177075491 TAGGCACAGGATGCGGGGCAGGG + Intergenic
984300655 4:177912652-177912674 TGGGTACAGGATGAGGGGAAGGG + Intronic
984382864 4:179017532-179017554 TGGGTACAGGATGGTGGGTGGGG - Intergenic
984417180 4:179477002-179477024 TGGGTACAGGATGGGGGGTGGGG - Intergenic
985269868 4:188183835-188183857 TGAGTACAGGATGCGGGGTCAGG - Intergenic
985281717 4:188293571-188293593 TAGAGAGAGGAGGCCGGGTACGG + Intergenic
985854808 5:2416575-2416597 TGGGCACAGGATGCAGGGCATGG - Intergenic
987005660 5:13707016-13707038 TGGGCACAGGATGCGGGGCATGG - Intronic
987268480 5:16280271-16280293 TAGGTACAGGATAGGGGGCAGGG + Intergenic
989963318 5:50441011-50441033 TGGGTACAGGGTCCAGGGTAGGG - Intronic
990936662 5:61157586-61157608 TAAGCACAGGAGGCCGGGTGCGG - Intergenic
993723011 5:91340322-91340344 TGGGTACAGGAGGCCTGGTGCGG - Intergenic
995279167 5:110313827-110313849 TAGGTACAGTAGGCAGTGTAAGG - Intronic
996557862 5:124797469-124797491 TAGGCACAGGATGTGGGGCAGGG - Intergenic
996710154 5:126535702-126535724 TGGGTACAGGATGGGGGGCATGG + Intergenic
998165158 5:139838553-139838575 TGGGTACGGGATGCTGAGTAGGG + Intronic
1001616515 5:173047464-173047486 TGGGTACAGGATGGGGGGTCTGG - Intergenic
1002405022 5:179023902-179023924 CAGGTACAGGCTGCCGGTGAGGG + Exonic
1003593928 6:7457982-7458004 TAGGTACAGGATAGGGGGTGTGG - Intergenic
1004647242 6:17574128-17574150 TGGGTACAGGATGGGGGATAGGG + Intergenic
1006798608 6:36745720-36745742 CAGGTACAGGGAGCCGGGTAAGG - Intronic
1010621819 6:78085889-78085911 TGGGTACAGGATGGGGGGCATGG + Intergenic
1012042945 6:94233805-94233827 TGGGTACAGGATGCAGGGGTTGG - Intergenic
1014224266 6:118830004-118830026 TGTGGACAGGATGCAGGGTAGGG + Intronic
1014820089 6:125979461-125979483 TAGGTAAAGTAGGCCGGGTGTGG + Exonic
1015277436 6:131398869-131398891 TAGGGGCAGGAGGCCGGGCACGG + Intergenic
1016422520 6:143900097-143900119 GAGGTACAGGGTGCTGGGTGTGG + Intronic
1016902113 6:149113302-149113324 TGGGTACAGGATGGGGGGTGTGG - Intergenic
1016922952 6:149314389-149314411 TAGGTAGAGGAGGGAGGGTAGGG - Intronic
1017633649 6:156423020-156423042 TGGGTACAGGATGCAGGGCGTGG + Intergenic
1017902871 6:158733615-158733637 TAGGTAGAGGTGGCCGGGCACGG - Intronic
1022394129 7:29970363-29970385 TTGGTACAGGAAGCAGGGAAGGG - Intronic
1022563021 7:31369480-31369502 CAGGCACAGGATGCCGGGTGGGG + Intergenic
1024493753 7:50017843-50017865 TAGGTACAGGATGCCGGGTATGG + Intronic
1025237952 7:57247358-57247380 AATGTACAGGCTGCTGGGTATGG + Intergenic
1025860620 7:65323721-65323743 TAGGTAAAGGAGGCCGGGCACGG - Intergenic
1027675690 7:81155000-81155022 AAGGTTCAGGATGCGTGGTAAGG - Intergenic
1029477515 7:100793864-100793886 TTGGCACAGGATGCTGGGCAGGG - Exonic
1029532897 7:101137204-101137226 TTGGGACAGGAAGCAGGGTAGGG - Intronic
1031063448 7:117077216-117077238 TAGGCACAGGATGCGGGGTGGGG + Intronic
1032370122 7:131340567-131340589 TAATTACAGGAAGCCGGGCACGG - Intronic
1033857204 7:145578050-145578072 TGGTTACAGGATGCAGGGCAGGG + Intergenic
1033970656 7:147034868-147034890 TAGGCACAGGATGAAGGGTGTGG + Intronic
1038200381 8:25407579-25407601 TAGGTTGAGGAGGCCGGGCATGG + Intronic
1041988438 8:63954855-63954877 TGGGTACAGGATGGGGGGTGTGG + Intergenic
1042238656 8:66640580-66640602 TGGGTACAGGATGGGGGGCAGGG - Intronic
1042257555 8:66821095-66821117 TGGGGAGAGGGTGCCGGGTATGG + Intronic
1043664668 8:82793772-82793794 GAGGTCCAGGATGCTGTGTAAGG + Intergenic
1044286853 8:90419958-90419980 TGGGCACAGGATGCGGGGAAGGG + Intergenic
1044765762 8:95572387-95572409 TAGGCACAGGATGGGGGGCATGG - Intergenic
1048900388 8:139031910-139031932 TAGGTACAGGATGGGAGGTGTGG + Intergenic
1050981216 9:12018200-12018222 TATGTACAGGATGGGGGTTATGG + Intergenic
1052122166 9:24731060-24731082 TAGGCACAGGATGGGGGGCAGGG + Intergenic
1055538882 9:77279494-77279516 TGGGCACAGGATGGTGGGTATGG + Intronic
1055788629 9:79898122-79898144 TTGGCACAGGATGCCAGGCACGG + Intergenic
1056301824 9:85249815-85249837 TAGGTACAGGATAGGGGGCATGG + Intergenic
1058132193 9:101265704-101265726 TGGTCACAGGAGGCCGGGTACGG + Intronic
1058236644 9:102498347-102498369 TAGGCACAGGATGGGGGGCATGG + Intergenic
1060584409 9:124777232-124777254 TAGGCACAGGCGGCCGGGCACGG - Intronic
1061182287 9:129031815-129031837 TAGGTACAGGATGGGAGGTGGGG - Intergenic
1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG + Intronic
1186036508 X:5429064-5429086 TGGGTACAGGATGGGGGGTGTGG + Intergenic
1187324447 X:18273776-18273798 TGGGCACAGGATGGGGGGTAAGG - Intronic
1188150788 X:26672581-26672603 TAGGTACAGGAGGCTTGGGAGGG + Intergenic
1188180569 X:27050493-27050515 TAGGTACAGGATGCAGGGCGGGG - Intergenic
1189301461 X:39955511-39955533 TGGGTACAGGATGCTGAGTGAGG + Intergenic
1191146000 X:57165921-57165943 TAGGCACAGGATGGGGGGCATGG - Intergenic
1191829402 X:65400014-65400036 TAGGTACAAGAGGCTGGGAATGG + Intronic
1193709339 X:84860554-84860576 TGGGTACAGGATGGGGGGTGTGG - Intergenic
1194690681 X:96980467-96980489 TGGGTACAGGATGGGGGGCAGGG + Intronic
1195647597 X:107249951-107249973 TGGGTACAGGATGGGGGGCAAGG + Intergenic
1195853249 X:109305683-109305705 TAGGGACAGGATGAGGGGTGGGG + Intergenic
1196824095 X:119727477-119727499 TAGTTGCAGGAGCCCGGGTAGGG + Intergenic
1200653933 Y:5877233-5877255 TAGGGACAGGGTGCAGGGGATGG - Intergenic
1201339864 Y:12922946-12922968 TAGGCACAGGATGGGGGGCATGG + Intergenic
1202019661 Y:20451446-20451468 TAGGCACAGGATGGAGGGCATGG - Intergenic