ID: 1024496092

View in Genome Browser
Species Human (GRCh38)
Location 7:50047448-50047470
Sequence TTGTATATGTACTCTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 1, 2: 4, 3: 51, 4: 473}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024496092_1024496097 -2 Left 1024496092 7:50047448-50047470 CCAGACACAGAGTACATATACAA 0: 1
1: 1
2: 4
3: 51
4: 473
Right 1024496097 7:50047469-50047491 AATGTGGGGAAAATGCCATAGGG 0: 1
1: 0
2: 1
3: 26
4: 214
1024496092_1024496099 12 Left 1024496092 7:50047448-50047470 CCAGACACAGAGTACATATACAA 0: 1
1: 1
2: 4
3: 51
4: 473
Right 1024496099 7:50047483-50047505 GCCATAGGGTTGCTGGTCTATGG No data
1024496092_1024496101 25 Left 1024496092 7:50047448-50047470 CCAGACACAGAGTACATATACAA 0: 1
1: 1
2: 4
3: 51
4: 473
Right 1024496101 7:50047496-50047518 TGGTCTATGGACACAGTAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 101
1024496092_1024496096 -3 Left 1024496092 7:50047448-50047470 CCAGACACAGAGTACATATACAA 0: 1
1: 1
2: 4
3: 51
4: 473
Right 1024496096 7:50047468-50047490 CAATGTGGGGAAAATGCCATAGG No data
1024496092_1024496098 5 Left 1024496092 7:50047448-50047470 CCAGACACAGAGTACATATACAA 0: 1
1: 1
2: 4
3: 51
4: 473
Right 1024496098 7:50047476-50047498 GGAAAATGCCATAGGGTTGCTGG No data
1024496092_1024496102 26 Left 1024496092 7:50047448-50047470 CCAGACACAGAGTACATATACAA 0: 1
1: 1
2: 4
3: 51
4: 473
Right 1024496102 7:50047497-50047519 GGTCTATGGACACAGTAGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024496092 Original CRISPR TTGTATATGTACTCTGTGTC TGG (reversed) Intronic
903073960 1:20747281-20747303 TTGTATTTCTGATCTGTGTCTGG - Intronic
903407324 1:23108764-23108786 TTGAATATTTACTCTATGTCGGG - Intronic
903936937 1:26902172-26902194 TGGAATATGGAGTCTGTGTCTGG - Intronic
905543676 1:38780649-38780671 TTGAGTATCTACTATGTGTCAGG - Intergenic
905920793 1:41717277-41717299 TTGAATACCTACTTTGTGTCAGG + Intronic
906013071 1:42547793-42547815 TTGTGTATCTACCATGTGTCAGG + Intronic
906327911 1:44859707-44859729 TTGTACATCTACTCTATGCCAGG + Intronic
906332479 1:44898432-44898454 TTGGACATTTACTCTGTGTCAGG - Intronic
906632588 1:47384921-47384943 TTATTTATCTACTCTGTGTCAGG - Intergenic
907593379 1:55697216-55697238 TTGTGTATCTACAGTGTGTCAGG - Intergenic
907760787 1:57357064-57357086 TTGAACATGTACTGTGTGCCAGG - Intronic
907966062 1:59331026-59331048 CAGGATATGTTCTCTGTGTCTGG + Intronic
909095917 1:71289138-71289160 TAATATTTGTCCTCTGTGTCTGG - Intergenic
909514218 1:76489338-76489360 TTGAGTATGTACTATGTGACAGG + Intronic
910309150 1:85803500-85803522 TGGTATATATACTATGTCTCTGG - Intronic
910781072 1:90933991-90934013 TTGAACATTTACTATGTGTCAGG - Intronic
910921282 1:92350330-92350352 TTATATATGTTCTGTGTGTAAGG - Intronic
911002139 1:93177709-93177731 TTGATTATTTACTATGTGTCAGG + Intronic
911468766 1:98289818-98289840 TTGCATATTTACTCTGTATCTGG + Intergenic
913317301 1:117563931-117563953 TTGAACTTCTACTCTGTGTCTGG + Intergenic
914700743 1:150130823-150130845 TTGAATATATACTATGTGCCAGG + Intronic
914873607 1:151496045-151496067 TTGATTATCTACTGTGTGTCAGG - Intergenic
915487133 1:156229470-156229492 TTGTATATATTGTCTCTGTCTGG - Intronic
915513126 1:156397679-156397701 CTGAAAATGTAGTCTGTGTCAGG - Intergenic
916023747 1:160816156-160816178 TTGAACATTTACTCTGTGTCAGG + Intronic
916312416 1:163411731-163411753 TTGATTGTGTACTATGTGTCAGG + Intergenic
916881524 1:169023853-169023875 TTTGATATATACTCTGAGTCTGG + Intergenic
917688359 1:177441758-177441780 TTGGATGACTACTCTGTGTCAGG + Intergenic
919148289 1:193662731-193662753 TTGAATATTTACTCTGGGTCAGG + Intergenic
919371654 1:196735101-196735123 GTGTGTATGTTCTATGTGTCGGG + Intronic
920698807 1:208202329-208202351 TTGAATATGTACTGTGTGCCAGG - Intronic
921345890 1:214184887-214184909 TTGAACATTTACTCTGCGTCAGG - Intergenic
923179409 1:231501579-231501601 TTGACTATATACTATGTGTCAGG + Intergenic
923185012 1:231563359-231563381 TTGAATATTTACTTTGTGTTGGG + Intronic
923332834 1:232941474-232941496 TTGTATATGTAGTCTGTCATTGG - Intergenic
924275640 1:242383966-242383988 TTGTGTTGGGACTCTGTGTCAGG - Intronic
1064102437 10:12475375-12475397 CTGTATGTGTCCTTTGTGTCTGG + Intronic
1066329562 10:34405190-34405212 TTGGGTAAGTACTATGTGTCAGG - Intronic
1066588479 10:36964909-36964931 TTGAATGTCTACTATGTGTCAGG - Intergenic
1067738627 10:48878551-48878573 ATGGAAATGTGCTCTGTGTCTGG - Intronic
1067920802 10:50455239-50455261 TTGTATATGAACTGTGTATATGG - Intronic
1068576594 10:58690581-58690603 TTCAATATTTACTCTTTGTCTGG + Intronic
1069758369 10:70788599-70788621 TTTTATATATACTCTTTATCAGG + Intergenic
1071250108 10:83809204-83809226 TTGAATAGGTACTCTGTGCCAGG - Intergenic
1071547873 10:86542227-86542249 TTCTATATGTACTCTTTGGAAGG - Intergenic
1071575827 10:86725450-86725472 TTGGATATTGACTGTGTGTCAGG + Intronic
1071798237 10:89028883-89028905 TTGTATTTCTACTCTGTGCCAGG + Intergenic
1072556501 10:96519031-96519053 TTGTATATGAATTCTGTGGTGGG - Exonic
1073672241 10:105605172-105605194 TACAATATGTACTCTCTGTCTGG - Intergenic
1074232973 10:111556002-111556024 TTGACTATGTACCATGTGTCAGG + Intergenic
1075290629 10:121227526-121227548 TTGAATACCTACTCTGTGTCAGG - Intergenic
1078134135 11:8638365-8638387 TTGAACATGTACTCTGTGCTTGG - Intronic
1078926476 11:15880021-15880043 TTGAGCATCTACTCTGTGTCAGG - Intergenic
1079474081 11:20809865-20809887 TTGTATATGTACTCAGTAGCGGG + Intronic
1079494520 11:21026682-21026704 TTGTGTATTTACTTTGTGTAAGG + Intronic
1079575177 11:21995360-21995382 CTGTATATGTATTCTGTACCAGG + Intergenic
1080224728 11:29948039-29948061 TTGAATATGTACTATATGCCAGG + Intergenic
1081289534 11:41307646-41307668 TTGTGCATGGCCTCTGTGTCTGG + Intronic
1081385089 11:42462612-42462634 TTATTTAATTACTCTGTGTCAGG + Intergenic
1082041309 11:47687489-47687511 TTGAATATTTACTGTGTGCCAGG - Intronic
1082807410 11:57459722-57459744 TTGTGTATGTATGATGTGTCCGG - Intergenic
1082899621 11:58232783-58232805 TTGAATGTGTACTCTGTGCTGGG - Intergenic
1083539240 11:63500701-63500723 TTGAATACTCACTCTGTGTCAGG + Intergenic
1084143002 11:67246269-67246291 TCATATATGTACAATGTGTCAGG + Intronic
1085371574 11:76011829-76011851 TTGAATTCATACTCTGTGTCAGG + Intronic
1085379409 11:76100368-76100390 TTGTGTATCTACTATGTGTCAGG - Intronic
1085734387 11:79026599-79026621 TTGAATATCTACTTTGGGTCAGG + Intronic
1085803112 11:79610119-79610141 TTGTACATCTACTGTGTGTTAGG + Intergenic
1086020164 11:82218200-82218222 TTGAATATCTGCTATGTGTCAGG - Intergenic
1086844229 11:91728784-91728806 TTATATATCTTCTCTGTTTCTGG - Intergenic
1086868220 11:92005871-92005893 TTGAATGTCTACTATGTGTCAGG - Intergenic
1086878251 11:92124074-92124096 GTATATATTTACTCTGTGTATGG + Intergenic
1086920127 11:92577060-92577082 TTGAAAATGTATTATGTGTCAGG + Intronic
1086964368 11:93012376-93012398 TTGTCTATTTCCTCTTTGTCTGG + Intergenic
1087657860 11:100947548-100947570 TTGGATATTTACTATGTGACAGG - Intronic
1087848210 11:102997448-102997470 GTGTATATTTGCTCTATGTCAGG + Intergenic
1088232579 11:107687845-107687867 TTGTATATGAACTATGTCTATGG + Intergenic
1089166739 11:116483281-116483303 TTGCATGTCTGCTCTGTGTCAGG - Intergenic
1089382525 11:118046024-118046046 TTGAATATCTACCATGTGTCAGG - Intergenic
1089931090 11:122313233-122313255 TTGTATAAGTACTCTGTAAGTGG - Intergenic
1090437315 11:126697444-126697466 TTGAATATCTCCTCTGAGTCAGG - Intronic
1091003880 11:131934445-131934467 ATGAATATTTACCCTGTGTCAGG - Intronic
1091015421 11:132046925-132046947 TTGAGTATTTATTCTGTGTCAGG + Intronic
1091109149 11:132949292-132949314 ATGTATATGTGGACTGTGTCTGG + Intronic
1091686267 12:2565041-2565063 CTGTATATTTTCTCTGTATCAGG + Intronic
1092040086 12:5376557-5376579 TTATATATGTAATCTTTCTCTGG - Intergenic
1093193472 12:16102507-16102529 TTGTATATGGATTTTGTGTAGGG + Intergenic
1093609864 12:21141094-21141116 TTGAATATCTACTCTGTGCAAGG + Intronic
1093855884 12:24101559-24101581 TTGAGTATCTACTATGTGTCTGG - Intergenic
1094561608 12:31559476-31559498 TTGTGTTTTTACTCTTTGTCTGG - Intronic
1095100487 12:38177024-38177046 TTACATGTTTACTCTGTGTCTGG + Intergenic
1095566071 12:43624414-43624436 TTGTATGTATACTGTGTGTATGG + Intergenic
1095914123 12:47458776-47458798 TTGAGTATGTACTATGTGCCAGG - Intergenic
1096421393 12:51461336-51461358 TTGAATATTTACTCTGTGCCAGG + Intronic
1097087734 12:56481034-56481056 TTGAACATTTACTTTGTGTCAGG - Intronic
1098457745 12:70694164-70694186 TTGCATATCTACTCTGTGCTAGG + Intronic
1098688596 12:73457678-73457700 TTGAAAATGTTCTCTGTGTTTGG + Intergenic
1098726596 12:73976240-73976262 TTGTTTTTGTGCTGTGTGTCTGG + Intergenic
1099134747 12:78882134-78882156 TTGAACATCTACTATGTGTCAGG - Intronic
1099721943 12:86374387-86374409 TTGTACATCTAATCGGTGTCAGG + Intronic
1099775777 12:87127283-87127305 TTGTATATGGCCTCTGTTGCAGG + Intergenic
1099877409 12:88425787-88425809 TTGAATATGTACTTTGTGTTAGG - Intergenic
1100574883 12:95881753-95881775 TTGTGTATGTCAGCTGTGTCTGG - Intronic
1100727706 12:97426580-97426602 TTGAATATTTACTGTGTGCCAGG + Intergenic
1100787825 12:98097147-98097169 TTGAACATCTACTCTGTGTTTGG + Intergenic
1101405366 12:104423913-104423935 TTGAAAATTTACTCTGTGCCAGG + Intergenic
1102048439 12:109844972-109844994 TTGAATATCTTCTATGTGTCAGG + Intergenic
1103066273 12:117900519-117900541 TTGAAAATGTACTGTGTGCCAGG + Intronic
1104908064 12:132225905-132225927 TTGTATATGTACAGTGTGTGGGG - Intronic
1105942780 13:25164724-25164746 TTGAATACTTACTATGTGTCAGG - Intronic
1106343975 13:28858423-28858445 TTGTATCTCTACTCTGTCCCTGG + Intronic
1106888275 13:34214308-34214330 ATGGAAATTTACTCTGTGTCTGG - Intergenic
1107372927 13:39771949-39771971 TTTTATTTCTACTCTGTGCCAGG - Intronic
1107587330 13:41865133-41865155 TAGTAAATGTATTCTGTGTGGGG + Intronic
1108110074 13:47061335-47061357 TTGTATATGTACACTAGATCTGG + Intergenic
1108222865 13:48255279-48255301 GTGTACATGTACTGTGTGTTTGG + Intronic
1108376330 13:49817591-49817613 TTGTATATGAACTGTATTTCAGG - Intergenic
1108401666 13:50051295-50051317 TTGAATATCTACTATGTGCCAGG + Intergenic
1108780707 13:53827879-53827901 TTGAATGTTTACTCTGTGCCAGG - Intergenic
1109769572 13:66953371-66953393 TTGAACATGTACTGTGTTTCAGG - Intronic
1109979019 13:69881453-69881475 TTGTATATATAATTTGTGTGAGG - Intronic
1110105753 13:71674103-71674125 TTGAATATCTGCTCTGTGCCAGG + Intronic
1110125370 13:71935612-71935634 TTGTGTATTTACCCTGTGCCAGG - Intergenic
1110460897 13:75744708-75744730 TTGAACATCTACTATGTGTCGGG + Intronic
1110645886 13:77883661-77883683 TTGTGTATCTACTCTGTTTCAGG + Intergenic
1111269143 13:85857095-85857117 TTGAGTATCTACTCTGTGTCAGG - Intergenic
1111571270 13:90089296-90089318 TTGTATGTGTAGTCTGTATATGG + Intergenic
1113081485 13:106525034-106525056 TTGAATATGTACTGTGTGCCTGG - Intronic
1113439522 13:110316834-110316856 GTGTATATATATTCTGTGGCTGG - Intronic
1114135911 14:19850327-19850349 TTGAACATCTACTCTGTTTCAGG + Intergenic
1116407858 14:44587170-44587192 TTGAATTTCCACTCTGTGTCAGG + Intergenic
1116409721 14:44607169-44607191 TTACATATGTACTCTGTGTCTGG + Intergenic
1116668320 14:47807656-47807678 TTGTATATTATCTCTGAGTCTGG - Intergenic
1116780090 14:49227604-49227626 TTGTAAATGAATGCTGTGTCAGG - Intergenic
1118581754 14:67307491-67307513 ATGATTATGTACTCTGTGCCAGG + Intronic
1119376924 14:74202083-74202105 TAAGATATGTACTCAGTGTCAGG - Intergenic
1119571377 14:75676503-75676525 GTTCATATATACTCTGTGTCCGG - Intronic
1119878617 14:78081607-78081629 TTGTGTGTCTGCTCTGTGTCAGG + Intergenic
1119962743 14:78879212-78879234 TTGGATATATACCCTGTATCAGG + Intronic
1120486996 14:85126575-85126597 TTGTATAGGTACTCGATGTGTGG + Intergenic
1120536231 14:85699496-85699518 CTGTATATAGACACTGTGTCAGG + Intergenic
1120653622 14:87163742-87163764 TTGAGCATGTACTATGTGTCAGG + Intergenic
1121073703 14:91049045-91049067 TTGTATTTGTAGTCTGTAGCGGG - Intronic
1121554490 14:94825951-94825973 TTGTGTACTTACTCTGCGTCAGG + Intergenic
1121947876 14:98140338-98140360 TTGAATATTTACTGTGTGTTGGG + Intergenic
1123501374 15:20885103-20885125 TTGTATATGTTGTTTGTGTGTGG - Intergenic
1123558627 15:21458808-21458830 TTGTATATGTTGTTTGTGTGTGG - Intergenic
1123594856 15:21896083-21896105 TTGTATATGTTGTTTGTGTGTGG - Intergenic
1124556803 15:30733654-30733676 TTTTATGTGTAATCTTTGTCAGG - Intronic
1125036192 15:35127034-35127056 TTGTATCTATCCTCAGTGTCTGG - Intergenic
1125306049 15:38315869-38315891 TTGAAGATTTACTATGTGTCGGG + Intronic
1126499798 15:49332872-49332894 TTGCATTTGTGCTCTGTGACTGG + Intronic
1126994976 15:54432121-54432143 TTAAATAGCTACTCTGTGTCAGG + Intronic
1127193263 15:56555592-56555614 TAGTATTTGTCCTCTGTGTCTGG + Intergenic
1127205724 15:56716143-56716165 TTGAACATTTACTGTGTGTCGGG + Intronic
1127302766 15:57673039-57673061 TTGTATATCTACTATATATCAGG - Intronic
1127349407 15:58135513-58135535 TTGAATATGTACCATGTGTCAGG - Intronic
1128885543 15:71283554-71283576 TTGAATATTTACTATGTGGCAGG + Intronic
1129367918 15:75068379-75068401 ATGTATATGTGCTCTGTGCTAGG + Intronic
1130520813 15:84659250-84659272 TAGCATAAGTACTCTGTGGCCGG + Intergenic
1131077880 15:89509455-89509477 TAGTATATATACTGTGTTTCAGG - Intergenic
1202966975 15_KI270727v1_random:185961-185983 TTGTATATGTTGTTTGTGTGTGG - Intergenic
1134421642 16:14097201-14097223 TTGCACATATACTCTATGTCTGG - Intronic
1134636733 16:15798361-15798383 TTGAACATGTACTCTGTGCCAGG - Intronic
1135945843 16:26864206-26864228 GTGTATATGTACTCACTGTGGGG - Intergenic
1137377256 16:47962901-47962923 TTGTACGTTTACTGTGTGTCAGG + Intergenic
1138611856 16:58131155-58131177 TTGAACATTTACTATGTGTCAGG + Intergenic
1138922472 16:61548660-61548682 TTATACAGATACTCTGTGTCAGG + Intergenic
1138972483 16:62162323-62162345 ATGAATATGTCCTTTGTGTCAGG + Intergenic
1139658349 16:68402992-68403014 GTGGATTTGTACACTGTGTCAGG + Intronic
1140800099 16:78479222-78479244 TTGAATACCTACTATGTGTCTGG + Intronic
1143505690 17:7363728-7363750 TTGAATCTGGGCTCTGTGTCTGG + Intergenic
1144425709 17:15139778-15139800 TTTTATATTTACTATGTGCCAGG - Intergenic
1149002926 17:51775560-51775582 TTGTGTATCTACTATGTGTCAGG + Intronic
1149245005 17:54695523-54695545 TTGAATATCTACTTTGTGCCAGG + Intergenic
1150819127 17:68420815-68420837 TTGAATGTCTGCTCTGTGTCAGG - Exonic
1150991056 17:70259671-70259693 TTGGATATGTCCTATGTGTGTGG - Intergenic
1151177300 17:72299399-72299421 TTAAATATGTACTCTGTGCCAGG - Intergenic
1153206517 18:2709120-2709142 TTATATTTGTCCTTTGTGTCTGG + Intronic
1154291740 18:13114491-13114513 ATGTATATATTCTTTGTGTCTGG + Intronic
1154460304 18:14576982-14577004 TTGGACATGTACTCTGTTTCAGG + Intergenic
1155637431 18:27972536-27972558 TTGCATATTTGTTCTGTGTCAGG - Intronic
1155695094 18:28675916-28675938 TTGCATATTTACTGTGTGCCTGG + Intergenic
1155768270 18:29665283-29665305 TCTCATATCTACTCTGTGTCAGG + Intergenic
1155793311 18:30001185-30001207 TTGGATACCTACTCTGTGCCTGG + Intergenic
1156055395 18:32997148-32997170 TACTATTTGTACTCTGTGTGTGG + Intronic
1156099422 18:33576131-33576153 TTCTACATTTACTTTGTGTCAGG - Intergenic
1156350957 18:36300426-36300448 CTGACTATGCACTCTGTGTCAGG - Intronic
1156891154 18:42190705-42190727 TTGAATATGAACTATGTGTTAGG - Intergenic
1157104919 18:44764939-44764961 TTGAACATGCACTCTGTGCCAGG - Intronic
1157599140 18:48882971-48882993 TTGAGCATGTACTCTGTGCCAGG + Intergenic
1158027834 18:52923126-52923148 TTTTATAACTAGTCTGTGTCTGG - Intronic
1158667602 18:59446827-59446849 TTGCATATGCTCTATGTGTCTGG + Intronic
1159423387 18:68251905-68251927 TTTTATATGAACTTTGTGTCTGG - Intergenic
1159705631 18:71683106-71683128 TTTTTTATGTACTTTGTGCCAGG - Intergenic
1162662372 19:12180565-12180587 GTGTATATGTTCTCTGTGGAGGG + Intronic
1165934473 19:39380851-39380873 TTGCCTGTATACTCTGTGTCTGG + Intronic
1167015815 19:46840337-46840359 TTCTATATGTTCTCAATGTCAGG + Intronic
1202646130 1_KI270706v1_random:143810-143832 TTGTATCTGTATTCTGAGACCGG + Intergenic
925287941 2:2727972-2727994 TTATATATGGTCTGTGTGTCTGG - Intergenic
926109908 2:10175320-10175342 TTGTATGTGGTCTTTGTGTCTGG + Intronic
926333311 2:11843888-11843910 TTGGATATGTACTCTGTGTCAGG - Intergenic
926438107 2:12858076-12858098 ATGTATATGTAGCATGTGTCTGG + Intergenic
926624512 2:15079856-15079878 TTAGTTATGTACTCTGTGCCTGG - Intergenic
927609255 2:24521484-24521506 TAATATTTGTCCTCTGTGTCTGG + Intronic
927911844 2:26905326-26905348 TTGTATATGTATTCTGTGACAGG - Intronic
928061712 2:28120205-28120227 TTGAATATCTACTGTGTGCCTGG + Intronic
928514421 2:32032541-32032563 TTGTATACGTATACTGTGACTGG - Intronic
928615358 2:33033106-33033128 TTGAATATTTACTGTGTGCCAGG + Intronic
928751384 2:34474579-34474601 TTGCATATGTACTGTGTTACAGG + Intergenic
928938910 2:36707736-36707758 TTGAAGATGTACTCCGAGTCAGG - Intronic
929308697 2:40397159-40397181 TTGGATATCTACTATGTGCCAGG - Intronic
929364304 2:41134333-41134355 TGGTATGTATCCTCTGTGTCTGG + Intergenic
929388887 2:41444720-41444742 TTGTATATGTGGTCTGTCTTTGG - Intergenic
929400154 2:41570544-41570566 TTGAATGTGTACTCTGTATCAGG + Intergenic
929971010 2:46576727-46576749 TTGTGTATTTACTGTGTGCCAGG + Intronic
930238765 2:48914073-48914095 TTGCATATGAGCTCTTTGTCAGG + Intergenic
930259636 2:49130239-49130261 TTAAGTATGTACTGTGTGTCAGG - Intronic
930289325 2:49473682-49473704 TAGGATATTTACTCTGAGTCAGG + Intergenic
931158411 2:59661412-59661434 TTGAACATTTACTCTATGTCTGG - Intergenic
935599824 2:104911634-104911656 TTTTTTATTTTCTCTGTGTCAGG - Intergenic
936896349 2:117432305-117432327 TTGAATATTTACTATGTGCCAGG + Intergenic
937327654 2:121001087-121001109 GTGTTTATTTACTCTGTGGCAGG + Intergenic
937551781 2:123102252-123102274 TTATATATGTGCTATGTGTTTGG - Intergenic
937575287 2:123413372-123413394 TTGTATTTGTATGCTGAGTCTGG + Intergenic
937674068 2:124570142-124570164 GTGGATATCTACTATGTGTCAGG - Intronic
937782039 2:125849644-125849666 TTGTCTGTTTACTCTGTTTCTGG + Intergenic
938107515 2:128543514-128543536 TTGAATATGTACACTGTCTTGGG + Intergenic
939059504 2:137403165-137403187 TTGTACATCTGCTCTGTGGCAGG - Intronic
939407887 2:141782832-141782854 TTGTATGTTTACTCTGTGTAAGG + Intronic
939583796 2:143983270-143983292 TTGTATATTTACTGTTTGCCTGG - Intronic
939673831 2:145047064-145047086 TTGAATGTGTACTTTATGTCAGG + Intergenic
939794741 2:146628928-146628950 TTGAACATTTTCTCTGTGTCAGG + Intergenic
939874498 2:147562286-147562308 TTGCATGTTTACTGTGTGTCAGG - Intergenic
939882878 2:147650091-147650113 TTGTCTAGGGACTCAGTGTCTGG + Intergenic
940248030 2:151641052-151641074 TTGAGTATCTACTATGTGTCAGG + Intronic
940369827 2:152888906-152888928 TTGGATAGATACTCTGTGTCAGG + Intergenic
941107336 2:161370801-161370823 TTAAAAATGTACTCTGTGCCTGG + Intronic
941135167 2:161706985-161707007 TTGAATATCTTCTATGTGTCAGG - Intronic
942084419 2:172430282-172430304 TTGTGTACCTACTGTGTGTCAGG + Intronic
942280769 2:174361874-174361896 TTGTATATGTATAGTGTATCTGG + Intronic
942433228 2:175939401-175939423 TTGAATATGTACTCTTTTGCAGG + Intronic
942439905 2:176021915-176021937 TTGAATACCTACTATGTGTCAGG - Intergenic
942595632 2:177589461-177589483 TTGTATATCTATTCTGGGTGAGG - Intergenic
942731851 2:179069120-179069142 TTAAATATGTACTCAGTGCCAGG + Intergenic
942792257 2:179774179-179774201 TAGTATATGTAGTGTGTGTGTGG + Intronic
942873977 2:180769489-180769511 TTGTGTGTGTACTCTCTGTCTGG - Intergenic
944059887 2:195561585-195561607 TTGAATATTTACTATGGGTCAGG - Intergenic
944175136 2:196820504-196820526 TTGAATACATACTATGTGTCAGG + Intergenic
944745916 2:202656100-202656122 TTGTATATTTTCTCTTTGTTTGG + Intronic
944796927 2:203196668-203196690 TTGGGTATGTACTATGTATCAGG - Intronic
945999542 2:216469712-216469734 TTGTGTATGTGCTTTGTGTAGGG + Intronic
946282331 2:218674990-218675012 TTGAATATTTACTATGTGCCAGG + Intronic
947163872 2:227241761-227241783 CTGCATATGTACTCTGTGCCAGG + Intronic
947336470 2:229090812-229090834 TTGAACATGTACTATGTGCCAGG + Intronic
947755144 2:232557417-232557439 TTGTGCACGTACTCTGTGCCAGG + Intronic
1169390211 20:5184665-5184687 TTGAATATGTACTCTGTGCTAGG + Intronic
1170107751 20:12769852-12769874 TTGTCTATGTACTCTGTTGATGG - Intergenic
1172669872 20:36627597-36627619 CTGTATATCTGTTCTGTGTCAGG - Intronic
1172946717 20:38694961-38694983 TTGTGCATCTACTATGTGTCAGG + Intergenic
1173221047 20:41133486-41133508 TTGGATGTGGACTCTGTGACAGG - Intergenic
1173697802 20:45035890-45035912 TTGAAAATGTACTATGTGCCAGG + Intronic
1174321390 20:49744404-49744426 TTGAACATTTACTCTGTGCCAGG - Intergenic
1174546842 20:51331959-51331981 TTGAATATGTTCTGAGTGTCAGG + Intergenic
1174731457 20:52922163-52922185 TTGCATATGTGCTGTGTGCCAGG + Intergenic
1175393376 20:58641777-58641799 TTGAGTATCTACTGTGTGTCAGG - Intergenic
1175556271 20:59859702-59859724 TTGTATCTGTAGTCTATTTCAGG + Intergenic
1175724043 20:61305082-61305104 TTGTGTATGCACTGTGTGTGTGG + Intronic
1176605747 21:8828937-8828959 TTGTATCTGTATTCTGAGACCGG - Intergenic
1176813805 21:13575838-13575860 TTGGACATGTACTCTGTTTCAGG - Intergenic
1177022157 21:15875443-15875465 TTGTATATTTACAAAGTGTCAGG + Intronic
1177075917 21:16573253-16573275 TAGGATAAGTAGTCTGTGTCAGG - Intergenic
1177654319 21:23998131-23998153 TTGGGTCTGTACTTTGTGTCAGG - Intergenic
1178332729 21:31713440-31713462 TTGTGTATTTACTCTGTGCTAGG - Intronic
1178906493 21:36641382-36641404 TTGAACATTTACTCTGTGCCTGG - Intergenic
1179982666 21:44904566-44904588 TAGTATGTGTGCTTTGTGTCTGG - Intronic
1180348044 22:11720542-11720564 TTGTATCTGTATTCTGAGACCGG - Intergenic
1180355819 22:11838636-11838658 TTGTATCTGTATTCTGAGACCGG - Intergenic
1180382438 22:12153691-12153713 TTGTATCTGTATTCTGAGACCGG + Intergenic
1180539484 22:16429805-16429827 CTGAATATCTACTCTGTGCCAGG - Intergenic
1182785066 22:32900457-32900479 TTGAATAAATACTCTGTGCCAGG + Intronic
1182900195 22:33891666-33891688 TGGTCTATGTACTGTGTGCCAGG - Intronic
1183008817 22:34927893-34927915 TTGAATATTTAGTCTGTGCCAGG - Intergenic
1184715049 22:46276966-46276988 TTGTATGTTTGCTGTGTGTCAGG - Intronic
949493975 3:4614415-4614437 TTGAATGTTTACTCTGTGCCAGG + Intronic
949760616 3:7466162-7466184 TTGTCTATGTGCAGTGTGTCAGG + Intronic
950413197 3:12852510-12852532 TTGAATAGCTGCTCTGTGTCAGG - Intronic
950778125 3:15367946-15367968 TTGATTATTTATTCTGTGTCAGG - Intergenic
950913016 3:16614898-16614920 ATGTATATTATCTCTGTGTCTGG - Intronic
952911291 3:38189695-38189717 TTGAAGGTGTACTCTGTGCCAGG + Intronic
955904296 3:63790379-63790401 ATGTTTATGTACTCTGAATCTGG + Intergenic
955945567 3:64190536-64190558 TTTTATACCTACTATGTGTCAGG - Intronic
956082745 3:65576969-65576991 TTGAACACTTACTCTGTGTCTGG - Intronic
956110170 3:65862333-65862355 TTGAGTATGAACTCTGTGGCAGG - Intronic
956168952 3:66417764-66417786 TTGTTTAAATCCTCTGTGTCTGG - Intronic
957031393 3:75246028-75246050 TTGAACATTTACTATGTGTCAGG + Intergenic
957760901 3:84554957-84554979 TTGTGTATTTACTATGTGCCAGG - Intergenic
957868602 3:86058073-86058095 TTGAGTATTTAATCTGTGTCAGG - Intronic
958044898 3:88271600-88271622 CAGTATATATACTCTGTGTTTGG + Intergenic
958682359 3:97347421-97347443 TTGTACATTTACTCTGTGATAGG - Intronic
958754159 3:98229976-98229998 TTGTATATCTCCACTGTGCCGGG - Intergenic
958866172 3:99504169-99504191 TTGTATATTTATACTGTGCCAGG + Intergenic
959040072 3:101411204-101411226 TTGTGTATTTACTATGTGCCAGG - Intronic
959277372 3:104293639-104293661 TTGAATATTTACTCTTTGCCAGG - Intergenic
960198077 3:114795506-114795528 TTGTATATGCAGTTTCTGTCTGG + Intronic
961434680 3:126908758-126908780 TTGAATATTTACTCTGTGCCAGG + Intronic
962172953 3:133122096-133122118 TTGTATATGTACGGTGCTTCTGG + Intronic
962410340 3:135135801-135135823 TTGAATGCGTACTCTATGTCTGG + Intronic
962490763 3:135891882-135891904 TTGCATCTGTTCTCTCTGTCTGG + Intergenic
962657851 3:137566836-137566858 TTGAATTTGAACTCTGTCTCTGG + Intergenic
962956570 3:140272309-140272331 TTGCATGGTTACTCTGTGTCTGG - Intronic
963043595 3:141086707-141086729 TTGCGTATGTCCTATGTGTCAGG - Intronic
963092827 3:141501428-141501450 TTGAATATTTACTCTGTCTTAGG + Intronic
963495020 3:146047189-146047211 TTGAATACCTTCTCTGTGTCAGG - Intergenic
963649468 3:147960042-147960064 TTGTATTTTTACTCTTTGGCAGG + Intergenic
964224706 3:154384770-154384792 TTGTAGAATTACTCTGTGCCAGG + Intronic
964324889 3:155534966-155534988 TTTTATAATTTCTCTGTGTCAGG + Intronic
964827671 3:160848114-160848136 TTAAATATGTACTATGTGTCGGG - Intronic
965787975 3:172356401-172356423 TTATTTATTTACTATGTGTCAGG - Intronic
966261884 3:177988171-177988193 TTGAGCATGTACTATGTGTCAGG - Intergenic
966438332 3:179915150-179915172 TTGAGTACCTACTCTGTGTCAGG - Intronic
970008839 4:11436454-11436476 TTCAGTGTGTACTCTGTGTCAGG - Intergenic
970948683 4:21726783-21726805 TTGCTTATCTACTTTGTGTCGGG - Intronic
971132881 4:23833029-23833051 TTGAACATCTACTCTGTGCCAGG + Intronic
971508459 4:27393522-27393544 TTTTATAGGTACTCTTTATCAGG + Intergenic
971860644 4:32100140-32100162 TTGAATATCTAATTTGTGTCAGG + Intergenic
972927278 4:44025777-44025799 TTGTATATGCATTCTTTTTCCGG - Intergenic
973133852 4:46681490-46681512 TTGTATCTTTTCTCTGTGTTTGG + Intergenic
973340297 4:48996449-48996471 TTGATTACTTACTCTGTGTCAGG + Intronic
973372362 4:49262057-49262079 TTGTATCTGTATTCTGAGACCGG + Intergenic
973388638 4:49533081-49533103 TTGTATCTGTATTCTGAGACCGG - Intergenic
973926583 4:55744856-55744878 TTGAATATGTACTAAATGTCAGG + Intergenic
974069830 4:57113442-57113464 TTTAAAATGTACTCTCTGTCAGG - Intergenic
974506911 4:62787301-62787323 TTTTATATATACCCTGTTTCAGG - Intergenic
975498148 4:75057061-75057083 TTGTAAATTTGCTCTGTGCCAGG - Intergenic
975582736 4:75921466-75921488 TTGAATATCTACACTGTGCCAGG + Intronic
975970702 4:80032564-80032586 TTGAATAGGTACTGTGTGTATGG + Intronic
975988362 4:80228537-80228559 TTGTGTATGTACTGAGTGCCAGG + Intergenic
976016792 4:80565097-80565119 ATGTTTATGTACTCTTTGACCGG + Intronic
976831366 4:89318451-89318473 TTGCGCATGTACTCTGTTTCTGG + Intergenic
978332801 4:107633334-107633356 TTGTATATTTACTGTGTGCCAGG - Intronic
978349290 4:107804401-107804423 TTGGGTATCTACTATGTGTCAGG + Intergenic
978952907 4:114582528-114582550 TTGTAAAAGTAGTCTGTATCTGG + Intergenic
979055480 4:115988110-115988132 ATGTATTTGAACTCTGTGTATGG + Intergenic
980241820 4:130188052-130188074 TTGTATGTTTACTATGTGTCAGG - Intergenic
980616432 4:135232317-135232339 ATGAATGTGTACTTTGTGTCAGG - Intergenic
980974168 4:139595165-139595187 TTGAATATTTACTATGTGCCAGG - Intronic
981137118 4:141223142-141223164 TTGTGCATCTACTCTGTGCCAGG + Intronic
982663812 4:158236233-158236255 TTGAGTATCTACTATGTGTCAGG - Intronic
982774818 4:159430830-159430852 TAGAAAATGTACTCTGGGTCGGG - Intergenic
983159286 4:164391075-164391097 TTGAATATCTACTATATGTCAGG + Intergenic
983518117 4:168678329-168678351 TTGCATATGTCCTATGTGCCCGG - Intronic
983811649 4:172069781-172069803 TTGAAAATGTACTCTATGGCAGG + Intronic
984111438 4:175621252-175621274 TTGTACATACACTTTGTGTCTGG - Intergenic
984195055 4:176649391-176649413 TTCTAAATCTACTCTGAGTCAGG + Intergenic
984553683 4:181189414-181189436 TTGTCTACCTACTCTGTGTTTGG - Intergenic
984769947 4:183428632-183428654 TTGTGTATGTACTCTTGTTCTGG - Intergenic
986057656 5:4154471-4154493 TTGTATCTGTCCTCAGTGTGGGG - Intergenic
986553647 5:8987011-8987033 TTGTATATTAACTCCGTGTCAGG + Intergenic
987597277 5:20018490-20018512 ATGTACATGAACTTTGTGTCAGG - Intronic
987713098 5:21529586-21529608 CTGAATATCTACTCTGTGCCAGG - Intergenic
988249993 5:28744906-28744928 TTGAATATCTAATCTATGTCTGG + Intergenic
988782110 5:34531803-34531825 TTGAGTACTTACTCTGTGTCAGG + Intergenic
988819389 5:34865912-34865934 TTGTATATCTACTATATGTTAGG + Intronic
990235590 5:53764080-53764102 TTGTATAAATACTATCTGTCTGG - Intergenic
990299142 5:54433303-54433325 TTGAATACCTACTATGTGTCAGG - Intergenic
990344931 5:54862689-54862711 TTGAATATCTATTTTGTGTCAGG - Intergenic
990480066 5:56201693-56201715 TTGAATATTTACTCTGGGCCAGG - Intronic
990496068 5:56349219-56349241 TTGTATAAGTACACTGTATGAGG - Intergenic
990928370 5:61056239-61056261 TTTTATATGCACTCTGTTTTTGG + Intronic
991429045 5:66524586-66524608 TTGAGCATGTACTGTGTGTCAGG - Intergenic
991661466 5:68955074-68955096 TACTATTTGTACTATGTGTCAGG + Intergenic
992007882 5:72496367-72496389 TTTGATATTTACTGTGTGTCTGG + Intronic
992904529 5:81333491-81333513 TTGTACATGTACTATGATTCAGG - Intronic
993078734 5:83269655-83269677 TTGAATATCTACTATGTGTTAGG - Intronic
993820374 5:92607617-92607639 TTGTATCTGTACTCTGAGAGTGG - Intergenic
994168824 5:96637179-96637201 TACTATATTTACTATGTGTCAGG + Intronic
996240338 5:121191502-121191524 TTATATAAGTACTCTGTGTAAGG - Intergenic
997697337 5:135871957-135871979 TTGAACACATACTCTGTGTCAGG + Intronic
997719965 5:136070403-136070425 TTGAATACGTACTGTGTGCCAGG - Intergenic
997838049 5:137212501-137212523 CTGAATATGTACTATGTGTCAGG + Intronic
997874320 5:137534999-137535021 TTGGATACCTACTATGTGTCAGG - Intronic
998096408 5:139397997-139398019 TTGTATACCTACTATGTGCCAGG - Intronic
998657104 5:144193603-144193625 TTGTTTATGATCTGTGTGTCTGG + Intronic
998985206 5:147749263-147749285 TTGAATATTTACTATGTGCCAGG + Intronic
999013513 5:148070144-148070166 TTGAATATCTACTATGTATCAGG + Intronic
999483422 5:151969968-151969990 TTGAACACCTACTCTGTGTCAGG + Intergenic
999638623 5:153648597-153648619 CTGAAAATGTACTGTGTGTCTGG - Intronic
999931900 5:156442747-156442769 TTGTATATTTACCTTGTATCAGG + Intronic
1000125188 5:158237081-158237103 TTGTAAATGTTCTCTCTGCCAGG + Intergenic
1000506267 5:162123638-162123660 TTGGGTATTTACTATGTGTCAGG + Intronic
1000965942 5:167656704-167656726 TTTTATATTTACTCTGTTACAGG + Intronic
1001155330 5:169267911-169267933 TAGTGTATGTGCTCTGTGACTGG - Intronic
1001369543 5:171184375-171184397 TAGTATTTGTCCTCTGTGCCTGG - Intronic
1001773141 5:174310836-174310858 TTGAATAGCTACTATGTGTCAGG + Intergenic
1001955797 5:175847372-175847394 TTGTAGATGCAACCTGTGTCGGG - Intronic
1002841900 6:913591-913613 TTGCATATTTACTATGTGTTGGG + Intergenic
1004048786 6:12052529-12052551 TTGAGTATCTACTCTGTGTCTGG + Intronic
1005497684 6:26402801-26402823 TTGTATATGTATGCTGGTTCAGG - Intronic
1005726026 6:28649713-28649735 TTGAATACCTACTATGTGTCAGG + Intergenic
1006489258 6:34372507-34372529 TTTTAAGTGTACTTTGTGTCAGG + Intronic
1007663305 6:43499579-43499601 TTGAATATGTACTCCCTGCCAGG + Intronic
1008041252 6:46800915-46800937 TTTTATAAATACTATGTGTCTGG + Intronic
1008146967 6:47903648-47903670 TTGAATGTATACTATGTGTCAGG + Intronic
1009003621 6:57752329-57752351 CTGAATATCTACTCTGTGCCAGG + Intergenic
1009467934 6:63996218-63996240 CAGTATTTGTACTCTGTGGCTGG - Intronic
1009505447 6:64471397-64471419 TTGTATATTGATTTTGTGTCTGG - Intronic
1009558679 6:65209565-65209587 TTTAATATGTATTATGTGTCAGG + Intronic
1009846736 6:69144923-69144945 TTTTATATGTCATCTTTGTCTGG + Intronic
1009949010 6:70374131-70374153 TTGTACAGGTACTTTATGTCTGG + Intergenic
1010070044 6:71733221-71733243 TTAAACATGTACTATGTGTCAGG - Intergenic
1010249600 6:73694266-73694288 TTGAATAGCTACTCTGTGCCAGG + Intergenic
1011516229 6:88156716-88156738 TTGAATACCTACTCTGTGCCAGG - Intronic
1011674062 6:89714087-89714109 TTGGATAACTACTCTGTGTTAGG - Intronic
1012123091 6:95391452-95391474 TTGTGTACCTACTATGTGTCAGG - Intergenic
1012812491 6:103978073-103978095 TTGAATATTTTCTCTGTGCCAGG + Intergenic
1013279700 6:108624017-108624039 TTGTATATATAAACTGTGTCAGG + Intronic
1013835660 6:114332453-114332475 TTGAACAGGTACTGTGTGTCAGG - Intronic
1014420463 6:121237953-121237975 TTTTTAATGTACTCTTTGTCAGG - Intronic
1015278936 6:131411632-131411654 TTGTATTAGTACTCTGTTTTTGG - Intergenic
1015515933 6:134082600-134082622 TTGTATATGAGCTTTGGGTCTGG - Intergenic
1016406402 6:143735992-143736014 TTGAGTATTTACTATGTGTCAGG + Intronic
1016427498 6:143950039-143950061 TTGTAGATGTTTTCAGTGTCTGG + Intronic
1016486897 6:144550568-144550590 TTGCATATCTGTTCTGTGTCAGG - Intronic
1017082063 6:150679653-150679675 TTGAGTATGTACTCTGTGCCAGG + Intronic
1020469836 7:8523676-8523698 TTGTATGCCTAGTCTGTGTCAGG - Intronic
1020909634 7:14112436-14112458 TAATATTTGTACTCTGTATCAGG - Intergenic
1020954797 7:14727640-14727662 TTAAATATCTACTATGTGTCAGG + Intronic
1021277803 7:18676249-18676271 TTGTATATGGACTCTTTCTTTGG + Intronic
1021834940 7:24660940-24660962 TTGTATTTCTACTCTGAGTGAGG + Intronic
1023155701 7:37249697-37249719 ATGTATACATACTCTGAGTCAGG + Intronic
1023585086 7:41720918-41720940 TTGAGCATGTACTATGTGTCAGG + Intergenic
1024496092 7:50047448-50047470 TTGTATATGTACTCTGTGTCTGG - Intronic
1025766490 7:64458590-64458612 TTGTTTATGTACTATTAGTCTGG - Intergenic
1026206837 7:68265023-68265045 TTGAGTGTGTACTCTGTATCAGG - Intergenic
1027638569 7:80705636-80705658 TTGAATATCTGCTATGTGTCTGG + Intergenic
1028447062 7:90936753-90936775 ATGCATATGCACGCTGTGTCTGG + Intronic
1028559345 7:92156623-92156645 TTGTATATTAACTCTGTATACGG + Intronic
1028756805 7:94445116-94445138 TTGTATATTTACTCTGTGAAAGG + Intergenic
1028962967 7:96770323-96770345 TTGAATATCTACTATGTGTCAGG + Intergenic
1029012855 7:97281101-97281123 TTGAATATCTATTCTGTGCCTGG + Intergenic
1030690609 7:112528787-112528809 TTGCACATCTACTATGTGTCAGG - Intergenic
1031283754 7:119839154-119839176 TTGCATGCATACTCTGTGTCAGG - Intergenic
1031726746 7:125249419-125249441 TTGGATCTTTACTATGTGTCAGG - Intergenic
1031842268 7:126758235-126758257 TTGCATATTTACACTGTGCCAGG + Intronic
1032728413 7:134613764-134613786 TTGAATATCTACTCTGTGCCAGG - Intergenic
1032753194 7:134863287-134863309 TTGAATATGTACTATGTGGCAGG - Intronic
1032872340 7:135999706-135999728 TTAAGTATGTACTCTGTGCCAGG + Intergenic
1032940405 7:136782139-136782161 GTGAGTATGTACTCTGTGTCAGG - Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1037340859 8:17843220-17843242 TTCTATATGTACCTTGTGTGAGG - Intergenic
1037794551 8:21981069-21981091 TTGAATACCTACTCTGTGCCAGG + Intronic
1038478276 8:27884210-27884232 TTGTATTTGCAGTCTGTGTGGGG - Intronic
1038945238 8:32351813-32351835 TGGTATATGCAGTGTGTGTCAGG + Intronic
1038946304 8:32364353-32364375 TTATATATGCACACTGTCTCAGG - Intronic
1040997360 8:53415323-53415345 TTGAATGTGTACTATGTGTATGG - Intergenic
1041559363 8:59197214-59197236 TTGAGCATGTACTCTGTGCCAGG - Intergenic
1041930207 8:63278333-63278355 TTGTGTATGTACTCTCTATGAGG - Intergenic
1042203263 8:66302713-66302735 TGGTATATAAGCTCTGTGTCTGG - Intergenic
1043793937 8:84511373-84511395 TTGAAAATGTACTATGTGCCAGG - Intronic
1043929117 8:86069910-86069932 TTTTATATGTTCACTTTGTCAGG - Intronic
1044255201 8:90052009-90052031 TTGAATATGTATTATGTGCCAGG + Intronic
1045004546 8:97906574-97906596 ATGTCTATCTAGTCTGTGTCTGG - Intronic
1045024092 8:98070216-98070238 TTGCATATGTTCTATGTGTAAGG - Intronic
1045049447 8:98309451-98309473 TTGAATGTTTACTCTGTATCAGG - Intergenic
1045208106 8:100064617-100064639 TTGTATATCTTCTGTGTGTTAGG - Intronic
1045813392 8:106251329-106251351 TTGTATATTGACTTTGTGTTTGG - Intergenic
1046104580 8:109650130-109650152 CTGTGTATCTGCTCTGTGTCTGG - Intronic
1047985554 8:130229612-130229634 TTGAATACCTACTCTGTGCCAGG - Intronic
1048504100 8:135005217-135005239 TTCTGTATTCACTCTGTGTCGGG + Intergenic
1049126322 8:140792272-140792294 TTTTACATGCACTCTGTGCCTGG - Intronic
1049231615 8:141487838-141487860 TTGCGTATGTGCTCTGTGCCAGG + Intergenic
1050057221 9:1668219-1668241 CTGAGTATCTACTCTGTGTCAGG - Intergenic
1050231578 9:3530985-3531007 TATGCTATGTACTCTGTGTCTGG - Intergenic
1051714425 9:19966741-19966763 TTGTATATCTACTTTTTGTTTGG - Intergenic
1052449904 9:28615479-28615501 TTGTGTGTCTACTTTGTGTCAGG - Intronic
1052593498 9:30529075-30529097 TTGAATATGTACTTTGTCTCAGG + Intergenic
1053103740 9:35393057-35393079 TTGAATATTTTCTCTGTGCCTGG + Intronic
1053393005 9:37749619-37749641 TTGAGTATCTACTGTGTGTCAGG + Intronic
1054352527 9:64030045-64030067 TTGTATCTGTATTCTGAGACAGG - Intergenic
1054813881 9:69456127-69456149 TTGTGCACGTACTGTGTGTCAGG - Intronic
1054845927 9:69798174-69798196 TTCTATGTGTTCTATGTGTCAGG - Intergenic
1054910192 9:70447838-70447860 TTGTATATTAACACTGTGTTGGG - Intergenic
1055641502 9:78322086-78322108 TTATATAAGCACTGTGTGTCAGG - Intronic
1055650880 9:78405727-78405749 TTGTATATCCACTCTGTGCATGG + Intergenic
1055671505 9:78611420-78611442 TTGTATCTGTTGTCTGTGACTGG + Intergenic
1055834782 9:80426101-80426123 TTTTATAATTACTGTGTGTCAGG + Intergenic
1056116111 9:83442748-83442770 ATGTATGTGGACTCTGTGTGAGG - Intronic
1056429779 9:86515722-86515744 TTGAATGTTTACTATGTGTCAGG + Intergenic
1056655395 9:88504561-88504583 TTGTATATGTGGTGTGTGTGTGG + Intergenic
1057496843 9:95568059-95568081 TTGTAGATGTAGTGTGTGTGTGG + Intergenic
1057822002 9:98339710-98339732 TTGAGTATGTACTATGTGCCAGG + Intronic
1058061699 9:100503995-100504017 TTGTGTACCTACTGTGTGTCAGG - Intronic
1058657597 9:107237817-107237839 TTGGGTTTGTACTCTGTGCCAGG - Intergenic
1058730107 9:107841585-107841607 TTGAATATCTACTGTGTGTCAGG - Intergenic
1058785016 9:108378421-108378443 TTGCATATGTACTGTGTTCCAGG - Intergenic
1059019201 9:110555272-110555294 ATGAACATGTACTCTGTGCCCGG - Intronic
1059623769 9:116038606-116038628 TTCTATATTTACTTTGTGCCAGG + Intergenic
1061278756 9:129585019-129585041 TTGAACATCTACTATGTGTCAGG - Intergenic
1203375599 Un_KI270442v1:373592-373614 TAGGATGTTTACTCTGTGTCTGG - Intergenic
1203624880 Un_KI270750v1:6168-6190 CTGTATATGTAAACTGTTTCAGG + Intergenic
1186259250 X:7758588-7758610 CAGTATTTGTCCTCTGTGTCTGG + Intergenic
1187696900 X:21931939-21931961 ATATATATGTACATTGTGTCTGG - Intergenic
1188636215 X:32435406-32435428 TTGAATATGTACTGTGTTCCTGG + Intronic
1188660253 X:32750510-32750532 TTGTATTTCTTCCCTGTGTCAGG + Intronic
1188749019 X:33883029-33883051 TTGAATATGTACTATGTGTCAGG - Intergenic
1188757588 X:33982956-33982978 TGGTATTTGTACTTTGTGACTGG - Intergenic
1189092162 X:38095324-38095346 TTGAGTACGTACTCTGTGTCAGG + Intronic
1189689519 X:43601315-43601337 TTGAATATGTATTATGTGTGGGG + Intergenic
1189901759 X:45713674-45713696 TTGGATATTTACTATGTGCCAGG - Intergenic
1190331857 X:49240946-49240968 TTCTAAGTGTACTCTGTGCCAGG + Intronic
1190420721 X:50281711-50281733 TTGTAAAAGTACTCTGATTCAGG - Intronic
1191781751 X:64876278-64876300 TTGTTTATGCAATCTGTGTTAGG + Intergenic
1191960323 X:66693896-66693918 TTGAATGTGTACTATTTGTCAGG - Intergenic
1191976214 X:66874385-66874407 CTGAATACCTACTCTGTGTCAGG - Intergenic
1194277293 X:91900970-91900992 CTGTGTGTCTACTCTGTGTCAGG + Intronic
1194763705 X:97824567-97824589 TTGAATTTGTACTATGTGACAGG - Intergenic
1194775227 X:97954935-97954957 TTGAATATTTACTATGTGCCAGG + Intergenic
1195553599 X:106196114-106196136 TTTTATATTGACTTTGTGTCTGG + Intronic
1196138325 X:112233808-112233830 TTGTATGTCTACTTTGTGGCAGG - Intergenic
1197019056 X:121664260-121664282 TTGTATATATACTTTGTGTCAGG + Intergenic
1197143603 X:123145051-123145073 TTGAATACCTACTATGTGTCAGG + Intergenic
1199296444 X:146164284-146164306 TTGAATATTTTCTCTGTGCCAGG - Intergenic
1199436140 X:147814757-147814779 TTATATATGTACTATATGCCAGG - Intergenic
1199965356 X:152815686-152815708 TAATATTTGTCCTCTGTGTCTGG + Intergenic
1200297613 X:154938260-154938282 TTGTTTCTGTACTCTATTTCAGG - Intronic
1200594635 Y:5123067-5123089 TTGTGTGTCTACTCTGTGTCAGG + Intronic
1200709033 Y:6467412-6467434 TTGTAGAGGTACTCTTTGTTGGG - Intergenic
1201025079 Y:9697297-9697319 TTGTAGAGGTACTCTTTGTTGGG + Intergenic
1201154412 Y:11116613-11116635 TTGTATCTGTATTCTGAGACCGG - Intergenic