ID: 1024497532

View in Genome Browser
Species Human (GRCh38)
Location 7:50065461-50065483
Sequence TAGGAAAAACAACCTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 2, 2: 10, 3: 47, 4: 353}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024497532_1024497534 7 Left 1024497532 7:50065461-50065483 CCTTGGGCAGGTTGTTTTTCCTA 0: 1
1: 2
2: 10
3: 47
4: 353
Right 1024497534 7:50065491-50065513 TGTGAAAGCCTTTTCTTATCAGG 0: 1
1: 0
2: 4
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024497532 Original CRISPR TAGGAAAAACAACCTGCCCA AGG (reversed) Intronic
902393766 1:16120944-16120966 GAGGCAACATAACCTGCCCATGG - Intergenic
903065241 1:20696076-20696098 GAGCTCAAACAACCTGCCCAAGG + Intronic
903232101 1:21928113-21928135 GAGGTAAAGCAACTTGCCCAAGG + Intronic
903327404 1:22577340-22577362 GAGGCAAAGCAACTTGCCCAAGG + Intronic
903474735 1:23611813-23611835 GAGGCTAAGCAACCTGCCCAAGG + Intronic
905276154 1:36819490-36819512 TAAGAAAACCACCCAGCCCAGGG - Intronic
905303352 1:37000511-37000533 GAGGTAAAATAACTTGCCCAAGG + Intronic
905717497 1:40165005-40165027 TAAGGAAAATAACATGCCCAAGG - Intronic
905894566 1:41536856-41536878 GAGGTTAAATAACCTGCCCAAGG + Intronic
905911336 1:41657004-41657026 GAGGAAATACAACTTGCACATGG + Intronic
906180721 1:43816247-43816269 TGGGAAAACCAACCAGCCCCTGG - Intronic
906536911 1:46556085-46556107 AAGGAAAAATAGCTTGCCCAGGG - Intergenic
906624201 1:47311744-47311766 TAGGAAAAAGAAACTGTCTAAGG + Intronic
907725521 1:57016926-57016948 AAGGAAAAGCAACTTGCTCAGGG + Intronic
908804567 1:67916786-67916808 GAGGTTAAACAACTTGCCCAAGG - Intergenic
909462255 1:75930383-75930405 TAGGAAAAACAAGGACCCCAAGG + Intronic
909486955 1:76185101-76185123 GAGGAAAACCAACTTGCTCAAGG + Intronic
909799466 1:79787920-79787942 TAGTAAAAACAACCTTACAATGG - Intergenic
910202586 1:84714663-84714685 GAGGAAAAGCAACTTGCCTAAGG + Intergenic
910729700 1:90381109-90381131 TAGGTCAAATAACCTGTCCAAGG + Intergenic
911519020 1:98906618-98906640 TAGGAAGAACACTCTGCCTAAGG + Intronic
912134434 1:106642746-106642768 CAGGTTAAACAACTTGCCCAAGG - Intergenic
912330819 1:108818629-108818651 TAGGTCAAGGAACCTGCCCAAGG + Intronic
912489837 1:110056378-110056400 AAGGATAAAGAACTTGCCCAAGG + Intronic
912523894 1:110266594-110266616 AAGGTAAAACGACTTGCCCAAGG + Intronic
912964220 1:114223370-114223392 GAGGAAAACCAGCCTCCCCATGG - Intergenic
913161997 1:116152936-116152958 GAGAAAAAAGAACTTGCCCAAGG + Intergenic
914958540 1:152186185-152186207 GAGGTTAAACAACCTACCCAAGG + Intergenic
915371817 1:155357650-155357672 CAGCAAAAACAGCCAGCCCATGG - Exonic
916040113 1:160954453-160954475 AAGGAAAAACAAGATGCACAAGG + Intronic
916697831 1:167258048-167258070 TAGGTAAAATAATTTGCCCAAGG + Intronic
921058705 1:211564400-211564422 GAGGAAAACCAACTTGCCCATGG + Intergenic
921394598 1:214655274-214655296 AAGGAAAATGAACGTGCCCAGGG + Exonic
921418294 1:214916199-214916221 TAGGAACAAAATCCTGCTCAGGG + Intergenic
921978566 1:221229203-221229225 TAGGTTAAATAACATGCCCAAGG - Intergenic
923261111 1:232268745-232268767 TATGATAAACATCCTGCTCATGG - Intergenic
923767730 1:236908248-236908270 GAGGGCATACAACCTGCCCAAGG - Intergenic
1062809870 10:455187-455209 TAGGTTAAGCAACTTGCCCAAGG - Intronic
1064985983 10:21210094-21210116 TAGGAAAAACATCATGGGCAGGG + Intergenic
1067485442 10:46645401-46645423 TAGGTTAAATAACCTGCCTAAGG + Intergenic
1067609318 10:47696262-47696284 TAGGTTAAATAACCTGCCTAAGG - Intergenic
1069537235 10:69263616-69263638 GAGGTGAAACAACCTGCCCCAGG - Intronic
1071709178 10:88032140-88032162 TAGGAAAAACTTCATGCACAAGG - Intergenic
1073288900 10:102403729-102403751 TAGGTTAAGCAACCTGCCCAAGG + Intronic
1073585665 10:104707682-104707704 CAGGTGAAACAAACTGCCCAGGG - Intronic
1073817731 10:107225649-107225671 CAGGAAAAAAAAACTGTCCATGG - Intergenic
1074402450 10:113153146-113153168 TAGTAAAAACAATCATCCCATGG - Intronic
1076271204 10:129153607-129153629 TAGGAAAAGTGACTTGCCCAAGG + Intergenic
1078952923 11:16155518-16155540 GAGGTTAAACAACTTGCCCAAGG - Intronic
1079677776 11:23252757-23252779 AGGGAAAATCAATCTGCCCATGG - Intergenic
1081100692 11:38998208-38998230 TAGGTAAAGCAACTTGCCTAAGG + Intergenic
1081582284 11:44360519-44360541 GAGGAAAACCAAGCTTCCCAAGG - Intergenic
1081637461 11:44729925-44729947 GAGGGGAAATAACCTGCCCAAGG - Intronic
1083059970 11:59859584-59859606 TGGGAAAAATAAACTGGCCATGG - Intronic
1084267365 11:68011948-68011970 GAGGTCAAGCAACCTGCCCAAGG + Intronic
1085043055 11:73338138-73338160 TAGGAAACAGGACCTGACCAGGG + Intronic
1085280429 11:75326512-75326534 GAGGTTAAATAACCTGCCCAAGG + Intronic
1085477678 11:76798226-76798248 CAGGGAGAACAAGCTGCCCAGGG - Intergenic
1085783155 11:79427588-79427610 TAGGAGAAACTACCTCTCCATGG + Intronic
1085801115 11:79590674-79590696 TAGAAGGAACAACCTGCTCAAGG + Intergenic
1085804935 11:79626862-79626884 GAGGAAAAAGAACCTGCACCTGG + Intergenic
1085820032 11:79782499-79782521 TAGGAAAAACAGGCTGCAGAGGG + Intergenic
1087003947 11:93450352-93450374 AAGGAAAAACAAAATGCCAAAGG + Intergenic
1087025291 11:93643605-93643627 CAGGGAACACAAACTGCCCAGGG + Intergenic
1087251167 11:95902138-95902160 GAGGTAGAACACCCTGCCCATGG - Intronic
1088506134 11:110529338-110529360 AAGGTTAAACAACCTGCTCAAGG - Intergenic
1088988275 11:114928953-114928975 TAGGTAAAATGACTTGCCCAAGG - Intergenic
1089685800 11:120146036-120146058 GAGGTAAAGCAACTTGCCCAAGG + Intronic
1089991273 11:122862590-122862612 TGAGAAAAATAACCTTCCCAAGG - Intronic
1090347177 11:126080824-126080846 AAAGATAAATAACCTGCCCATGG - Intergenic
1090932664 11:131312362-131312384 GATGAAAAACAGCCTCCCCAGGG - Intergenic
1090981977 11:131730831-131730853 TAGAATCAACAACCTGCCCAGGG + Intronic
1091946356 12:4547845-4547867 TAGGATAAGCAACTTGCCCATGG + Intronic
1092780529 12:11982191-11982213 GAGGATGAGCAACCTGCCCATGG + Intergenic
1094186391 12:27647315-27647337 TAAGAAAAAGAACCTGGCCAGGG - Intronic
1095608030 12:44093595-44093617 TAAGAAAAAGAAACTTCCCATGG - Intronic
1096365911 12:51027938-51027960 TATGAAAACCAACCTGCTCCAGG - Intronic
1096684391 12:53278138-53278160 TAGGTTAAGCAACTTGCCCAAGG - Intronic
1098067826 12:66638393-66638415 GAGGTTAAATAACCTGCCCAGGG + Intronic
1102195683 12:111023657-111023679 GAGGTAAAGCAACTTGCCCAAGG + Intergenic
1102196576 12:111029688-111029710 GAGGTAAAATAACTTGCCCAAGG + Intergenic
1102210132 12:111120565-111120587 TAGGAAAATCTAGCTGCCTAGGG + Intronic
1102432297 12:112893058-112893080 TAAGAAAACCAATCTGCACATGG - Intronic
1102640611 12:114363197-114363219 AAGGTAAAACAACTTGCCCCTGG + Intronic
1102708164 12:114900788-114900810 AAGGCTAAACAACTTGCCCAAGG - Intergenic
1103202996 12:119104084-119104106 GAGGAAAAGAAACTTGCCCAAGG - Intronic
1104324696 12:127785238-127785260 AAGGTTAAACATCCTGCCCAGGG - Intergenic
1106562397 13:30858106-30858128 CAGGAACAACAACGGGCCCATGG - Intergenic
1107207036 13:37804192-37804214 TAGGACATACCACCTACCCAGGG - Intronic
1109897324 13:68710790-68710812 TAGGAAAAACCTCCTGGCCGGGG - Intergenic
1110145546 13:72186280-72186302 AAGGAAAAGCAACCTTCCCAAGG + Intergenic
1110695269 13:78480743-78480765 TAGGAAAAATAAGCTACCAAAGG - Intergenic
1112123532 13:96439575-96439597 TAGGAAGAGCAATTTGCCCATGG - Intronic
1114355275 14:21900803-21900825 TTGGAGAAACAACCTGCACAAGG - Intergenic
1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG + Intergenic
1116824121 14:49655320-49655342 TAGGTTAAGTAACCTGCCCAGGG + Intronic
1117068104 14:52031002-52031024 GAGGCCAAATAACCTGCCCAGGG + Intronic
1119996121 14:79255479-79255501 AAGGTAAAACATCTTGCCCAAGG - Intronic
1120001202 14:79305077-79305099 TAGAAAAAGAAACTTGCCCAAGG - Intronic
1120208367 14:81610057-81610079 AAGGATAAGTAACCTGCCCAAGG - Intergenic
1121101813 14:91254610-91254632 GAGGGCAAACAACTTGCCCAAGG + Intergenic
1121141639 14:91547746-91547768 AAGAAAAAAGAACTTGCCCAGGG + Intergenic
1122102979 14:99428316-99428338 TAGGAAAAGTAATCTGCCAAAGG + Intronic
1123946030 15:25239334-25239356 TAGGGCAACCAACCTGCTCATGG - Intergenic
1124789530 15:32714946-32714968 TAGGAAAAAAAAATTGCACATGG - Intergenic
1125857040 15:42960632-42960654 TAGTAAAACCAACCTGACCACGG + Exonic
1126182502 15:45799422-45799444 TAGGTCAAGTAACCTGCCCAAGG - Intergenic
1126433941 15:48616932-48616954 AAGGTCAAACAACCTGGCCAAGG + Intronic
1126503997 15:49381286-49381308 TAGGAAATAAAACCTTCCCCAGG - Intronic
1126556093 15:49989097-49989119 TAAGACAAACAACCTTGCCAAGG + Intronic
1128260757 15:66231335-66231357 TAGGACACATAATCTGCCCAGGG + Intronic
1128446218 15:67763556-67763578 AACCAAAAACAACCTGTCCAAGG - Intronic
1128462815 15:67884193-67884215 AAGGTTAAACAACTTGCCCAAGG - Intergenic
1128519313 15:68365006-68365028 GAGGCCAAACAACCTGCCCAAGG + Intronic
1128773253 15:70299718-70299740 AAGGTAAAATAACTTGCCCAAGG - Intergenic
1129027212 15:72588261-72588283 TGGGAAAAAAAAACTGCCCATGG - Exonic
1129210097 15:74063468-74063490 GAGGAAAAGTCACCTGCCCAAGG - Intergenic
1129403926 15:75301934-75301956 GAGGAAAAGTCACCTGCCCAAGG + Intergenic
1129448750 15:75637425-75637447 TTGGAATAGCAACCTGTCCAAGG - Intergenic
1129842109 15:78750300-78750322 GAGGAAAAGCCACCTGTCCAAGG + Intergenic
1130860959 15:87889148-87889170 TAGGAAAAATGACTTGCCCAGGG - Intronic
1131758469 15:95592911-95592933 GAGGCACAAGAACCTGCCCAAGG + Intergenic
1133465356 16:6021755-6021777 GAGGTAAAGCAACTTGCCCAAGG - Intronic
1133909031 16:10048143-10048165 TAGGTGAAATAACTTGCCCATGG - Intronic
1133984778 16:10660276-10660298 TCAGAAAAAGAGCCTGCCCAAGG + Intronic
1134361184 16:13532483-13532505 TAGTGAGATCAACCTGCCCACGG - Intergenic
1135228270 16:20680645-20680667 TAGGAGAAATAACCTGCCTAGGG + Intronic
1136112576 16:28074051-28074073 AAAGAGAAACAACCTGCCCAAGG + Intergenic
1136298228 16:29315991-29316013 TAGGAAACACCACCTGCGCTTGG - Intergenic
1136514204 16:30757888-30757910 TAGGTTAAATAACCTGCCTAAGG - Exonic
1137816928 16:51407110-51407132 GAGGGAAAATGACCTGCCCAAGG + Intergenic
1139949017 16:70660298-70660320 AAGGAAAAACACCCTTCCCAGGG - Exonic
1141129948 16:81429479-81429501 GAGGAAAATGAACCTCCCCAGGG + Intergenic
1141146636 16:81535307-81535329 GAGGTCAAGCAACCTGCCCAAGG + Intronic
1141423800 16:83932889-83932911 GAGGCAAAACAGCCTTCCCAAGG - Intronic
1142959987 17:3546628-3546650 TAGATAAAGCAACTTGCCCAAGG + Intronic
1143364313 17:6396011-6396033 CAAGACACACAACCTGCCCAAGG + Intronic
1144022122 17:11246766-11246788 TATGAAACACATCTTGCCCAGGG - Intronic
1145040104 17:19571405-19571427 TAGGCAAAACATACTCCCCAGGG + Intronic
1145258703 17:21342149-21342171 GAGGCAAAGCAACCTGCCCAAGG + Intergenic
1145317926 17:21745855-21745877 GAGGCAAAGCAACCTGCCCAAGG - Intergenic
1145788404 17:27609121-27609143 TAGGTAAATCATCCAGCCCAGGG + Intronic
1145843493 17:28016910-28016932 TAGGAAAAACCACCTGGACCTGG - Intergenic
1146531058 17:33608063-33608085 TAGGAAATACAATCGGGCCAAGG + Intronic
1146889765 17:36498953-36498975 GAGGCTAAACAACCTGCCCAAGG + Intronic
1146930588 17:36774684-36774706 GAGGAAAAAATACTTGCCCAAGG - Intergenic
1148219892 17:45853857-45853879 GAGGGAAAGCAGCCTGCCCAAGG + Intergenic
1148714757 17:49708051-49708073 TAGGAAAGAAAACCCGCCCTGGG + Exonic
1148759479 17:49992089-49992111 GAGGTTAAACAACTTGCCCAAGG - Intronic
1148777132 17:50102114-50102136 TAGGATCAAGAACCGGCCCAAGG + Intronic
1148933216 17:51143941-51143963 AAGGTTAAATAACCTGCCCAAGG - Intergenic
1150221865 17:63500150-63500172 CTGCAAAAACAAACTGCCCAAGG - Intronic
1150271011 17:63865121-63865143 TAGCATAAACAACCAGCTCAGGG + Intergenic
1150274596 17:63888323-63888345 TAGCATAAACAACCAGCCCAGGG + Intergenic
1150276732 17:63903122-63903144 TAGCATAAACAACCAGCCCGGGG + Intergenic
1151050629 17:70974397-70974419 TATGAAAAACAACACACCCAAGG - Intergenic
1151204348 17:72494990-72495012 TAGGATAAAGAGCTTGCCCAAGG + Intergenic
1151336527 17:73443192-73443214 AAGGAAGGAAAACCTGCCCAGGG - Intronic
1151400211 17:73850962-73850984 GAGGTTAAACAACCTGCTCAAGG - Intergenic
1151486708 17:74405533-74405555 GAGAAGCAACAACCTGCCCAAGG + Intergenic
1151546517 17:74796612-74796634 GAGGAAAACCAACCTCTCCATGG - Intronic
1151867678 17:76815200-76815222 TGGGAGAGAAAACCTGCCCAGGG - Intergenic
1153331068 18:3875591-3875613 TAGGTTAAGTAACCTGCCCAAGG - Intronic
1153704730 18:7733872-7733894 CAGAAAAGAGAACCTGCCCAGGG - Intronic
1154148772 18:11888976-11888998 TAGGTAAAACAACAGGACCATGG + Intronic
1156286095 18:35697620-35697642 TAGAGTAAATAACCTGCCCAAGG + Intronic
1156743938 18:40366698-40366720 CAGGAAAAGCAACTTGCCCAAGG + Intergenic
1157123574 18:44934728-44934750 GAGGTAAAGCAACTTGCCCAAGG + Intronic
1159123087 18:64192679-64192701 TGGGAAAAAAAACCTGAACATGG + Intergenic
1159480804 18:68988990-68989012 CAGCAAAAACAGCCTGACCAAGG - Intronic
1160692983 19:468514-468536 TAGGATAAATAACTTGGCCAAGG - Intronic
1160774415 19:848440-848462 GATGAATAACAACCTGCCCAGGG - Intergenic
1161407531 19:4098908-4098930 TTGGAAAATCCAACTGCCCAGGG + Intronic
1162504183 19:11073088-11073110 AAAGAAAAATAACTTGCCCAAGG + Intergenic
1164010462 19:21199056-21199078 TAGGAGAAACAACCTGCCTAGGG - Intergenic
1164029794 19:21393773-21393795 AAACAAAAACAACTTGCCCAAGG - Intergenic
1164054557 19:21611130-21611152 TGTGAGAAACAACCTGCCTAGGG + Intergenic
1164446304 19:28320308-28320330 TAGGAAAAACAAACATCCCTAGG + Intergenic
1165393707 19:35552514-35552536 GAGGCAAAGCAACCTGCCCAGGG + Intronic
1165865499 19:38934598-38934620 GAGTGTAAACAACCTGCCCAAGG - Intronic
925052152 2:824193-824215 CAGGAGAAACCACCTGCCCATGG - Intergenic
925486370 2:4336569-4336591 GAGGAAAAACAACCTGAAGAAGG + Intergenic
925772076 2:7292220-7292242 TATGAAAAACAATCTCTCCAGGG + Intergenic
925787554 2:7447847-7447869 TGGGACAAACTACCTGCCCAGGG + Intergenic
926861826 2:17317859-17317881 TGGGAAAAACAAACTGAACAGGG + Intergenic
927054170 2:19354843-19354865 TAGGCATACCCACCTGCCCAGGG - Intronic
927251898 2:21003193-21003215 TCTGAAAGACAACGTGCCCAAGG - Exonic
927825334 2:26305121-26305143 TAGGAGAAACAACCTGCCTAGGG + Intergenic
928236775 2:29548823-29548845 AAGGAAAAACATCCCCCCCAAGG - Intronic
928414091 2:31077197-31077219 TAGGATAAACGACAAGCCCAAGG + Intronic
928465836 2:31521471-31521493 AAAGAAAAACAACTTGACCAGGG - Intergenic
929468493 2:42168741-42168763 TAGAGAGGACAACCTGCCCAAGG - Intergenic
931973229 2:67613569-67613591 CAGGAAAAAATACATGCCCAAGG - Intergenic
932001578 2:67890000-67890022 TAGGTAAAACAACCTGGTCATGG + Intergenic
932414553 2:71565717-71565739 GAGGTTAAGCAACCTGCCCAAGG - Intronic
932840093 2:75073775-75073797 TAGGAAGGAGAATCTGCCCAGGG - Intronic
933235456 2:79859404-79859426 TCGGTAAAAGATCCTGCCCAAGG - Intronic
933763752 2:85693686-85693708 TAGGAAAAACATCTTTCCCAGGG - Intronic
933792503 2:85894352-85894374 GAGATAAAACAACCTGCCCAGGG + Intergenic
934140676 2:89044343-89044365 AAGGAAACAAAACCTTCCCAAGG - Intergenic
934228561 2:90156199-90156221 AAGGAAACAAAACCTTCCCAAGG + Intergenic
936560645 2:113536472-113536494 GAGGGAAAGCAACTTGCCCAAGG + Intergenic
936562507 2:113553591-113553613 TAGGAAAAATTAGCTGGCCATGG - Intergenic
937247295 2:120501933-120501955 GAGGAAGAAGGACCTGCCCAGGG + Intergenic
939612108 2:144324091-144324113 TAGGTAAAGTATCCTGCCCAAGG + Intronic
939865730 2:147470241-147470263 AAGTAAAAACAACCTGGCAATGG - Intergenic
941584304 2:167337635-167337657 TAGAAAAAAGAAACTGCTCAAGG - Intergenic
942868592 2:180707392-180707414 AAGGGAAAGAAACCTGCCCAAGG + Intergenic
944027156 2:195184380-195184402 TAGAAAAGAAACCCTGCCCATGG - Intergenic
945512302 2:210717731-210717753 AAGGTAAAACAAGTTGCCCAAGG + Intergenic
946010013 2:216557178-216557200 GAGGTTAAATAACCTGCCCAGGG + Intronic
946418780 2:219553351-219553373 TGGGAAAAATTACCTACCCAAGG - Intronic
947082437 2:226413482-226413504 GAGGTTAAACAACTTGCCCAAGG + Intergenic
1168938169 20:1685912-1685934 GAGGCAAAACCATCTGCCCAAGG - Intergenic
1168972967 20:1943418-1943440 GAGGAAAATCAACCTGGCCAAGG - Intergenic
1169520940 20:6372436-6372458 TAGTAAAGAAAACCTGGCCATGG - Intergenic
1170508715 20:17055186-17055208 AAGGAAACACCCCCTGCCCAGGG - Intergenic
1171947759 20:31393393-31393415 TTGGTTAAACAACTTGCCCATGG - Intergenic
1172840143 20:37897898-37897920 TAAGAGAAATAACTTGCCCAAGG + Intergenic
1172930534 20:38583286-38583308 GAGGAGAAGCAACCTGTCCAAGG + Intronic
1173084143 20:39899165-39899187 AAAGAAAAGCAACTTGCCCAAGG + Intergenic
1173255502 20:41391983-41392005 TAGGCAAAACTTCCTGCCCTGGG - Intergenic
1173597090 20:44265576-44265598 TAGGGAAAGCAACTTGTCCAAGG - Intronic
1174338445 20:49881230-49881252 GAGGGCAAACAACATGCCCAGGG + Intronic
1174342990 20:49909562-49909584 TAAGAAAAAGAAACTGTCCAAGG + Intronic
1174904121 20:54532245-54532267 GAGGTTAAACAACCTGCCCAAGG + Intronic
1175166881 20:57050245-57050267 TAGGAAAACGAAACTGCCAATGG - Intergenic
1175226737 20:57449004-57449026 TAGGGAAAACAGCCTGTCCAAGG + Intergenic
1175317298 20:58057912-58057934 GAGGTAAATTAACCTGCCCAAGG - Intergenic
1175915772 20:62425038-62425060 GAGGAAAAGCAACTTGCCCAAGG - Intronic
1176236526 20:64056206-64056228 TGGGAAGAGCCACCTGCCCAGGG - Intronic
1176346243 21:5750731-5750753 TAGGAAAAACAACCTTCCTAGGG - Intergenic
1176353057 21:5871315-5871337 TAGGAAAAACAACCTTCCTAGGG - Intergenic
1176498584 21:7573724-7573746 TAGGAAAAACAACCTTCCTAGGG + Intergenic
1176540564 21:8148801-8148823 TAGGAAAAACAACCTTCCTAGGG - Intergenic
1176559515 21:8331846-8331868 TAGGAAAAACAACCTTCCTAGGG - Intergenic
1178184472 21:30204228-30204250 TATGAAAAACAAGCTGGGCATGG - Intergenic
1179709069 21:43201773-43201795 AAGGAGAAAAAACCTGCCAATGG - Intergenic
1181859204 22:25805252-25805274 CAGGAGAAACCACTTGCCCAGGG + Intronic
1181935033 22:26432215-26432237 TAGGAAAAGCGATCTGCCCAAGG + Intronic
1181938481 22:26456303-26456325 TAGGATAAGCAGCTTGCCCAGGG - Intronic
1181997361 22:26893389-26893411 TGGGCAAAACAACCAACCCACGG + Intergenic
1182366127 22:29780612-29780634 GAGGGGAAACAACCTGCCCAAGG - Intergenic
1182554818 22:31123395-31123417 GAGGAAAAGCAACTTGGCCAAGG - Intronic
1182751937 22:32648646-32648668 GAGGTTAATCAACCTGCCCATGG - Intronic
1183213183 22:36463639-36463661 ATGGAAAAGCAGCCTGCCCAAGG + Intergenic
1183466390 22:37982480-37982502 TAGGAAAAACATCCCCCGCAGGG - Intronic
1203245506 22_KI270733v1_random:65219-65241 TAGGAAAAACAACCTGCCTAGGG - Intergenic
949258381 3:2077751-2077773 TAGCAAAATCCACCTCCCCAGGG + Intergenic
949471276 3:4399620-4399642 AAGAAAAAACAATCTGTCCAGGG + Intronic
950194502 3:10999689-10999711 GAGGGGAAAGAACCTGCCCACGG - Intronic
951607621 3:24453332-24453354 TAGGAAAATTAATTTGCCCAAGG + Intronic
951934931 3:28011995-28012017 TAGGTTGAACAACCTTCCCAAGG + Intergenic
952401988 3:32971672-32971694 TAGGAGAAACAACCTGCCTAGGG + Intergenic
953051860 3:39351591-39351613 TAAGAGAAACAACCTGCCTAGGG + Intergenic
955057335 3:55468017-55468039 TATGAAAGCCAACCTGCCTAAGG + Exonic
955130968 3:56168152-56168174 GAGGATAAGCAACCTGCCCATGG - Intronic
955177588 3:56632078-56632100 ATAGAAAAACAAACTGCCCAGGG - Intronic
955541315 3:59979528-59979550 TAGGAAAAAAAATGTCCCCAAGG - Intronic
955848202 3:63191294-63191316 TAGGCAAGGCAACTTGCCCAAGG + Intergenic
959779392 3:110210390-110210412 TAGGAAACACAATATGTCCAGGG - Intergenic
960102055 3:113754231-113754253 TAGGAAAAACAGGCTGGGCATGG + Intronic
961519773 3:127460342-127460364 GAGGCAAAGCAACTTGCCCATGG + Intergenic
961646107 3:128393618-128393640 TAAGAGATGCAACCTGCCCAGGG + Intronic
961717234 3:128866182-128866204 GAGGTAAAATGACCTGCCCAGGG + Intergenic
961809660 3:129514570-129514592 GAGGAGAAGCCACCTGCCCAAGG - Intronic
963046622 3:141107157-141107179 CAGGAAAAACACACTCCCCAAGG + Intronic
963738061 3:149043790-149043812 TAGGTTAAGCAACCTGTCCAAGG - Intronic
965199277 3:165635704-165635726 CAGGAAAAGCAACATGGCCAGGG + Intergenic
965578534 3:170243638-170243660 TACTAAAAACCATCTGCCCAAGG - Intronic
966635057 3:182123823-182123845 AAGGATAAGCAACTTGCCCAAGG + Intergenic
968798822 4:2728410-2728432 TAGAAAAACGAAACTGCCCATGG - Intronic
968916884 4:3500492-3500514 TAGGAAAAGCTCCCTGGCCAAGG - Intronic
969968263 4:11019351-11019373 GAAGAAAAACAACCTGCATATGG + Intergenic
971461897 4:26908364-26908386 TAGGAAAAGCAATTTGCCCAAGG - Intronic
971543357 4:27851332-27851354 AATGTAAAATAACCTGCCCAGGG + Intergenic
971918574 4:32908192-32908214 AAGGAGAAACAACATGGCCAGGG + Intergenic
973993982 4:56438001-56438023 AAGAAAAATCAACCTGCCAACGG - Intronic
975680835 4:76874308-76874330 TGGGAAACACCCCCTGCCCATGG + Intergenic
976005966 4:80431187-80431209 CAGATAAAACATCCTGCCCAAGG - Intronic
976087210 4:81418712-81418734 TAGGAAAAGGAACCTCCTCAGGG + Intergenic
976770855 4:88651439-88651461 TAGAAAAGTTAACCTGCCCAAGG - Intronic
976776355 4:88710470-88710492 TAGGTTAAGAAACCTGCCCAAGG - Intergenic
978582174 4:110243103-110243125 TAAGAAGAACAATATGCCCATGG + Intergenic
979514082 4:121586952-121586974 TAGGAAAAACATGCTTCCCTTGG - Intergenic
980321402 4:131282933-131282955 TAGGACACCAAACCTGCCCATGG + Intergenic
980718742 4:136664085-136664107 TAGGAAAAATAAGCTGGGCATGG + Intergenic
981431517 4:144666825-144666847 GAGGTTAAACAACTTGCCCAAGG - Intronic
981863283 4:149382576-149382598 CAGGAAAAAAAAAATGCCCAGGG - Intergenic
984004484 4:174292917-174292939 TAGTAAATACAACATGCCAAAGG - Intronic
984795937 4:183659722-183659744 TAGGAGAAACACCGTCCCCATGG - Intronic
987724084 5:21674872-21674894 TAGGAAAAAAAATCAGGCCAGGG - Intergenic
989668410 5:43884833-43884855 AAGGAAAAACAAAATGGCCATGG - Intergenic
991968183 5:72112206-72112228 AAGGAAAATCAACTTGCCAAAGG + Intronic
992894503 5:81234710-81234732 TAGGAAAACTGACCTGCCTATGG - Intronic
993324919 5:86522257-86522279 TAGGAATAAAAACCTGTCAAGGG - Intergenic
993977625 5:94501428-94501450 GAAGAAAAACAACCTATCCAAGG + Intronic
994717241 5:103336286-103336308 CAGAATACACAACCTGCCCAAGG - Intergenic
996184253 5:120457344-120457366 TAGGAACAACTCCCTGGCCACGG + Intergenic
997724578 5:136109824-136109846 AAGGACAAACAAGCTGCCCCAGG + Intergenic
998795488 5:145813627-145813649 TAGGTTAAATAACTTGCCCAAGG - Intronic
998930493 5:147176026-147176048 GAAGTTAAACAACCTGCCCAAGG - Intergenic
999054492 5:148559469-148559491 AAGGAAAAACAACATACTCATGG - Intronic
999251028 5:150182510-150182532 TAGGCAAAACAACCAGCTCAGGG - Intronic
1000119172 5:158180170-158180192 AAGGAGAAGCAACTTGCCCAAGG - Intergenic
1001047641 5:168387112-168387134 TAGGATCAACAATGTGCCCAGGG + Intronic
1001153226 5:169250450-169250472 GAGGAAAAATAATTTGCCCAAGG + Intronic
1001213928 5:169837701-169837723 GAGGAAAAGCAATTTGCCCAAGG + Intronic
1001432315 5:171672608-171672630 TAGGTGAAACGTCCTGCCCAAGG - Intergenic
1001646576 5:173286625-173286647 GAGGATAAATGACCTGCCCAGGG + Intergenic
1002125833 5:177043345-177043367 TATGTAAAATAACTTGCCCAGGG - Intronic
1003539826 6:7008726-7008748 TAGGGAATAGAGCCTGCCCAGGG + Intergenic
1004548194 6:16619935-16619957 GAGGATAAGCAACTTGCCCAAGG - Intronic
1004584267 6:16984341-16984363 TAGGAAAATCAATCTGGCAATGG - Intergenic
1004733237 6:18379647-18379669 GAAGAAAAACACCTTGCCCAGGG - Intergenic
1005231359 6:23705104-23705126 AAGGAATAACATCCTGGCCATGG - Intergenic
1005588837 6:27303775-27303797 TAAGAAAAACACCCTAGCCAAGG + Intronic
1006387553 6:33739763-33739785 TAGGAAACAGAACAGGCCCAGGG - Intronic
1006840837 6:37027096-37027118 TAGGCAACACAGCCTGCCCCTGG + Intronic
1006901943 6:37508078-37508100 TGAGAAAAGCAACCTGCCCTGGG - Intergenic
1007766458 6:44163195-44163217 GAGGTCAAACAACTTGCCCAAGG + Intronic
1008619850 6:53260996-53261018 GAGGATAAATGACCTGCCCAAGG - Intergenic
1009667915 6:66706651-66706673 TAGTAAATAAAACCTCCCCAAGG - Intergenic
1010009751 6:71036420-71036442 CAGGAAAGGCAACCAGCCCATGG + Intergenic
1010383498 6:75250908-75250930 AAGGAAAGACAACATGCCCTGGG + Intergenic
1010416557 6:75618090-75618112 GAGGAAAAACAAACTGACAATGG - Intronic
1012421328 6:99068880-99068902 GAGGTTAAGCAACCTGCCCAAGG + Intergenic
1013061674 6:106640055-106640077 TAGGTAAACCATCCTGTCCAGGG - Intronic
1013545077 6:111148748-111148770 TTGGTTAAACAACTTGCCCAAGG - Intronic
1013726462 6:113103040-113103062 CATGAAAAACATCCTGACCACGG + Intergenic
1013803418 6:113971269-113971291 TAGGGTGAACAACCTGCGCAAGG + Exonic
1014132229 6:117847187-117847209 GAGGAAAAACAACCATCCAAAGG + Intergenic
1017294898 6:152782338-152782360 TATGAAAAATAACCTGCTCTTGG + Intergenic
1017407558 6:154136336-154136358 TACGAAGAACACTCTGCCCAAGG + Intronic
1020559473 7:9712948-9712970 AGGGAAAAATAACCTGCCCTAGG + Intergenic
1020985707 7:15131884-15131906 GAGGAAATGCAACCAGCCCAAGG + Intergenic
1021715574 7:23459001-23459023 TGGGAGAAGCAACCTGCCTAAGG - Intronic
1024093640 7:45967738-45967760 TGGGGAAGACCACCTGCCCAAGG - Intergenic
1024497532 7:50065461-50065483 TAGGAAAAACAACCTGCCCAAGG - Intronic
1024897165 7:54273346-54273368 GAAGAAAAGGAACCTGCCCACGG - Intergenic
1027423438 7:78039602-78039624 GAATAAAAACAACCTGCTCAGGG - Intronic
1027438981 7:78197856-78197878 TGGGACAAACCACCTGCCCTGGG + Intronic
1028156486 7:87435574-87435596 GAGGAAAAGCAACCTGCCTTAGG + Intronic
1028163640 7:87513320-87513342 TAGGAAACAGAAACTGCCCTAGG - Intronic
1029328891 7:99834720-99834742 TAGGAGAAACAATCTGCCTAGGG - Intronic
1030081374 7:105781780-105781802 GAGGCAAAGTAACCTGCCCAAGG + Intronic
1031023674 7:116656277-116656299 TAGGAAAAACAACCTGAGGATGG - Intergenic
1031883059 7:127218458-127218480 GAGGCAAAATAACTTGCCCAAGG - Intronic
1032186113 7:129728060-129728082 TTGGCAAGACAAGCTGCCCAAGG + Intronic
1032843522 7:135733711-135733733 TAGGCAAACCATTCTGCCCATGG + Exonic
1033958040 7:146876302-146876324 AAGGAAAAAGAACATGCCCTGGG - Intronic
1035479804 7:159172364-159172386 AAGGAAAAACCAAGTGCCCACGG - Intergenic
1037407168 8:18555133-18555155 TCAGAAAAACAACCGGCCAAAGG + Intronic
1037413961 8:18628450-18628472 AAGGAAAAACAACCTGCCAAAGG + Intronic
1037875714 8:22546852-22546874 AAGGAAAAACAAGCTCCCCTGGG + Intronic
1038710594 8:29940807-29940829 TAGAAAAAACAGTCTGCCCTAGG + Intergenic
1043922577 8:86000520-86000542 TACAAAACACAACCTGTCCAGGG - Intronic
1044306117 8:90643409-90643431 GAGAATAAACAACTTGCCCAAGG + Intronic
1044611972 8:94100345-94100367 GAGGAAAAACAGCCAGCACAAGG - Intergenic
1045714877 8:105030273-105030295 TATGAAAAAGATCCTGGCCACGG + Intronic
1046139450 8:110071183-110071205 TAGGAAAAAAAGGCTGCCCATGG - Intergenic
1046907495 8:119589407-119589429 GAGAAAAAAAAACCTTCCCATGG - Intronic
1048344351 8:133565789-133565811 GAGGTTAAACAACGTGCCCAAGG + Intronic
1049581252 8:143412072-143412094 TAGGACCAACTGCCTGCCCAAGG - Intergenic
1049890179 9:61742-61764 TAGGAAAAATTAGCTGGCCATGG + Intergenic
1049892035 9:78850-78872 GAGGGAAAGCAACTTGCCCAAGG - Intergenic
1049933844 9:481918-481940 TAGGACAAACAAGAAGCCCAGGG + Intronic
1050428412 9:5536169-5536191 AAGGCAAAATAACCTGCCCAAGG - Intronic
1050714237 9:8503545-8503567 TATGCAAAACAATCTGCCCTGGG + Intronic
1051336804 9:16073002-16073024 GAGGTAAAGCAACTTGCCCAAGG - Intergenic
1053425867 9:38009497-38009519 GAAGAGAAGCAACCTGCCCAAGG + Intronic
1053733457 9:41079949-41079971 GAGGGAAAGCAACTTGCCCAAGG - Intergenic
1054694964 9:68351616-68351638 GAGGGAAAGCAACTTGCCCAAGG + Intronic
1054732490 9:68715197-68715219 CAGGAAAAACTTCCTGACCAAGG + Intronic
1055296199 9:74836341-74836363 AAGGAAAAATAACCTGCATATGG + Intronic
1056104638 9:83334843-83334865 GAGGTTAAACAACCTACCCAAGG - Intronic
1056201842 9:84284487-84284509 GAGGAAAAGCAGCCTGCCTAAGG - Intronic
1056225844 9:84494235-84494257 AAGGAAAAACAAGCTGTGCATGG + Intergenic
1056501708 9:87216048-87216070 AAGGAAGAACAGCCTGCCAAGGG + Intergenic
1057753419 9:97810307-97810329 GAGGACAAACACCCAGCCCAGGG - Intergenic
1057956721 9:99415379-99415401 GAAGAGAAACAACCTGCTCAGGG + Intergenic
1058096249 9:100863422-100863444 TAAGAAAAACAACCTTCCTGGGG + Intergenic
1058746757 9:107999156-107999178 TTGGAAGAGCAGCCTGCCCACGG + Intergenic
1058872432 9:109214036-109214058 GAGGCAAAACAACGTACCCAGGG - Intronic
1059215950 9:112562330-112562352 GAGGTAAAATAACTTGCCCAAGG + Intronic
1059459211 9:114419194-114419216 GAGGAGAAGCAACTTGCCCAAGG - Intronic
1061162290 9:128902320-128902342 GAGGCAAAACCACCTGCCCAAGG - Intronic
1061294896 9:129671763-129671785 CAGGCAAAGCAACCTGCCCGAGG + Intronic
1061950188 9:133931766-133931788 CAGGGAAAGCCACCTGCCCAGGG + Intronic
1062563143 9:137150685-137150707 CAGAAAAAAAGACCTGCCCAGGG + Intronic
1203461845 Un_GL000220v1:48291-48313 TAGGAAAAACAACCTGCCTAGGG - Intergenic
1186090901 X:6047985-6048007 AAGGAAAAACAGCCTGGTCATGG + Intronic
1186749611 X:12607620-12607642 TAGGAAAAATAACTTGGCCAAGG - Intronic
1187073656 X:15913249-15913271 TAGAAAAAACCTCCTGCACAAGG - Intergenic
1187153654 X:16704236-16704258 AAGGATAAATAACTTGCCCAAGG - Intronic
1187254372 X:17628755-17628777 GAGGTTAAACAACTTGCCCAAGG - Intronic
1187586050 X:20662993-20663015 GAGGCAAATTAACCTGCCCAAGG - Intergenic
1188633246 X:32395068-32395090 TAGAAACATCAACATGCCCAAGG + Intronic
1189354642 X:40301368-40301390 TAGGAAAAACAGTTTCCCCAAGG - Intergenic
1190069746 X:47270023-47270045 AAAGAAAAATAACGTGCCCAAGG - Intergenic
1190343354 X:49314971-49314993 TAGGAGAAACAACCTGCCTAGGG + Intronic
1190714280 X:53090867-53090889 CAGGAGAAGCAACCTGCCTAAGG + Intergenic
1192694243 X:73398187-73398209 TAGGAGAAACACCCTGCTCATGG + Intergenic
1192709441 X:73564209-73564231 GAGAAAAAGCAACCTGACCAAGG - Intronic
1195720083 X:107858859-107858881 GAAGGAAATCAACCTGCCCATGG - Intronic
1196610563 X:117709792-117709814 AAGGTTAAACAACTTGCCCAAGG + Intergenic
1196678948 X:118451178-118451200 TAGGATAAATAACTTGCCCAAGG - Intergenic
1196867254 X:120081454-120081476 CAGGAGAAACAACCTGCCTAGGG - Intergenic
1196875845 X:120154828-120154850 CAGGAGAAACAACCTGCCTAGGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1202071433 Y:20995767-20995789 TAGGAGAAACAACCTGTCTAAGG + Intergenic
1202336850 Y:23820954-23820976 CAGGGAAAACAAACTGCACAGGG + Intergenic
1202533915 Y:25849117-25849139 CAGGGAAAACAAACTGCACAGGG - Intergenic