ID: 1024497758

View in Genome Browser
Species Human (GRCh38)
Location 7:50067874-50067896
Sequence AGTTAGAGTTAGAACTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024497755_1024497758 22 Left 1024497755 7:50067829-50067851 CCTGGATAAGTATGTCACTGGGT 0: 3
1: 1
2: 2
3: 14
4: 87
Right 1024497758 7:50067874-50067896 AGTTAGAGTTAGAACTGGTGTGG No data
1024497756_1024497758 -5 Left 1024497756 7:50067856-50067878 CCATGACTTTATGACTTGAGTTA 0: 1
1: 2
2: 5
3: 23
4: 180
Right 1024497758 7:50067874-50067896 AGTTAGAGTTAGAACTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024497758 Original CRISPR AGTTAGAGTTAGAACTGGTG TGG Intronic
No off target data available for this crispr