ID: 1024498360

View in Genome Browser
Species Human (GRCh38)
Location 7:50072208-50072230
Sequence GGCAATAATCCCACTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024498350_1024498360 21 Left 1024498350 7:50072164-50072186 CCAGGCCAGGAAGCATGGGCCTT 0: 1
1: 0
2: 1
3: 16
4: 264
Right 1024498360 7:50072208-50072230 GGCAATAATCCCACTGGCCTGGG No data
1024498349_1024498360 22 Left 1024498349 7:50072163-50072185 CCCAGGCCAGGAAGCATGGGCCT 0: 1
1: 0
2: 3
3: 23
4: 288
Right 1024498360 7:50072208-50072230 GGCAATAATCCCACTGGCCTGGG No data
1024498356_1024498360 2 Left 1024498356 7:50072183-50072205 CCTTAAGGGAACATTGGTGGTAG 0: 24
1: 54
2: 146
3: 307
4: 505
Right 1024498360 7:50072208-50072230 GGCAATAATCCCACTGGCCTGGG No data
1024498352_1024498360 16 Left 1024498352 7:50072169-50072191 CCAGGAAGCATGGGCCTTAAGGG 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1024498360 7:50072208-50072230 GGCAATAATCCCACTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024498360 Original CRISPR GGCAATAATCCCACTGGCCT GGG Intronic
No off target data available for this crispr