ID: 1024500922

View in Genome Browser
Species Human (GRCh38)
Location 7:50104832-50104854
Sequence GAAGCTAGTGAGAATGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024500922_1024500925 15 Left 1024500922 7:50104832-50104854 CCAGCTGCATTCTCACTAGCTTC 0: 1
1: 0
2: 1
3: 11
4: 215
Right 1024500925 7:50104870-50104892 TCTTCTGTCTTCCCTCCCCTTGG 0: 1
1: 0
2: 7
3: 59
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024500922 Original CRISPR GAAGCTAGTGAGAATGCAGC TGG (reversed) Intronic
900844483 1:5085720-5085742 GATGCGAGGGAGAATGCAGGAGG - Intergenic
901157478 1:7150200-7150222 TGAGCAAGTGAGATTGCAGCTGG - Intronic
901722922 1:11214872-11214894 GGAGCTGATGATAATGCAGCTGG - Intronic
903280835 1:22248998-22249020 GAAGCTGGTGAGACTGGACCTGG + Intergenic
903835766 1:26202401-26202423 GAAGCTGGTGAGACTGGAGGAGG + Intronic
904276342 1:29387199-29387221 TTACCCAGTGAGAATGCAGCAGG + Intergenic
906088389 1:43156156-43156178 GAAGCCTGTGAGGATGCAGGAGG - Intronic
906475648 1:46167595-46167617 GAACCTGGTGAGACTACAGCTGG - Intronic
912429519 1:109621574-109621596 GAAGCATGTGTGAATGGAGCGGG + Intronic
912682467 1:111738322-111738344 GAAGCCAGTGAGAATCAACCTGG + Intronic
913331721 1:117673069-117673091 GAAGCTTGTGCCAAAGCAGCAGG + Intergenic
913598263 1:120398029-120398051 GAATGTAGTGAGAATGTAGGGGG + Intergenic
914089067 1:144481287-144481309 GAATGTAGTGAGAATGTAGGGGG - Intergenic
914309545 1:146452925-146452947 GAATGTAGTGAGAATGTAGGGGG + Intergenic
914512147 1:148343660-148343682 GAATGTAGTGAGAATGTAGGGGG - Intergenic
914592565 1:149120213-149120235 GAATGTAGTGAGAATGTAGGGGG - Intergenic
914846139 1:151284357-151284379 GAAGGTAGTGAGCGAGCAGCAGG + Intronic
916518111 1:165538940-165538962 TAGGCTGGTGAGAATGTAGCTGG - Intergenic
917402274 1:174663196-174663218 GCACTTACTGAGAATGCAGCTGG - Intronic
918037232 1:180885922-180885944 GAAGCTAGTCAGAATAAAGATGG - Exonic
920834584 1:209497886-209497908 GAAGCAAGAGAGCAGGCAGCAGG + Intergenic
922905710 1:229172183-229172205 GAAGACACTGAGAAAGCAGCAGG - Intergenic
923057897 1:230441660-230441682 GGAGCTATTGAGAGGGCAGCTGG + Intergenic
1065447277 10:25815910-25815932 GAAAATAGTGAGAAAGCAGAAGG - Intergenic
1068392488 10:56415922-56415944 GAAGCCAGTTAGAATGGAGAAGG - Intergenic
1069808846 10:71143731-71143753 GAAGTTGGTGACAATCCAGCTGG - Intergenic
1070313873 10:75293359-75293381 GGAGCCAGTGGGAGTGCAGCTGG + Intergenic
1071171268 10:82867688-82867710 GAAGAGATTGAGAATGCAGAAGG + Intronic
1071564886 10:86666690-86666712 GAAGCCAGTCAGAGAGCAGCTGG - Intronic
1073682392 10:105718394-105718416 GAAGGAAGTGAGAAAGCAGGTGG - Intergenic
1073998649 10:109345023-109345045 GAAGCTAGTGTTAAAGCAGGTGG - Intergenic
1076504041 10:130960128-130960150 GAAGGAAGTGAGGATGAAGCTGG - Intergenic
1076772310 10:132672754-132672776 GAACCTAGAGGGAATGCAGAGGG - Intronic
1079366643 11:19815730-19815752 GAAGCCAGTGAGATACCAGCTGG - Intronic
1081671939 11:44947359-44947381 GGGTCTGGTGAGAATGCAGCAGG + Intronic
1081988904 11:47327162-47327184 GCTGCTAGAGAGATTGCAGCAGG - Intronic
1083079810 11:60079450-60079472 AAAGCTATAGAGAAAGCAGCTGG - Intergenic
1083785896 11:64946722-64946744 AAAGCTAATAAGAATGCTGCTGG - Intronic
1084013156 11:66363811-66363833 GAATCCAGAGAGAATGAAGCTGG - Intronic
1085025833 11:73236028-73236050 ACAGCTAGTGAGAAGGCAGGTGG - Exonic
1085077134 11:73601197-73601219 GAAGCTAGAGACGCTGCAGCGGG - Intergenic
1086863178 11:91948900-91948922 GGAGTCAGTGAGAATGCTGCAGG - Intergenic
1087280124 11:96200653-96200675 GAAGCTCCTGAGAAGTCAGCAGG - Intronic
1087998019 11:104835818-104835840 CAAGCTACTAAGAATGAAGCAGG - Intergenic
1089153348 11:116382158-116382180 GTAGATATTGAGAATACAGCCGG + Intergenic
1089529874 11:119120842-119120864 GAAGCAAGTGTGCACGCAGCGGG + Intergenic
1090397625 11:126429597-126429619 GAAGGAAGTGAGAATTCAGTAGG - Intronic
1093420097 12:18965084-18965106 TAACCTAGTGAGACAGCAGCTGG - Intergenic
1094136096 12:27128193-27128215 AAAGCTGGTCAGAAAGCAGCAGG - Intergenic
1094185657 12:27639928-27639950 AAAGCTGGTCAGAAAGCAGCAGG - Intronic
1095396564 12:41768802-41768824 GAAGGTAATGAGCATGGAGCAGG + Intergenic
1096535263 12:52268109-52268131 GGAGCCTGTGAAAATGCAGCAGG - Intronic
1097842840 12:64338708-64338730 GAAGCCAATGAGAAAGCAGAAGG - Intronic
1097966355 12:65585670-65585692 GTAGCTAATGAGAGTGGAGCTGG - Intergenic
1101286116 12:103314306-103314328 GAAGCAATTTAGAAGGCAGCCGG + Intronic
1102716424 12:114977302-114977324 AAAGTTAGTGAGAATGCCACAGG - Intergenic
1103589374 12:121980386-121980408 GAAGGAAGTGAGAATGAAGAGGG - Intronic
1104727551 12:131087417-131087439 GAAGCTACTGAGGAGGCTGCCGG - Intronic
1105111496 13:16624307-16624329 GAAGTTTCTGAGAATGCTGCTGG - Intergenic
1105798176 13:23878917-23878939 GTAGGTACTGAGGATGCAGCTGG + Intronic
1110522744 13:76499889-76499911 GAAGTTTGTGAGAATTTAGCTGG + Intergenic
1112016421 13:95335121-95335143 TTAGCTAGTGAGAATGCTGTTGG - Intergenic
1112162548 13:96884066-96884088 GATGGTAGTCACAATGCAGCAGG + Intergenic
1112637105 13:101227267-101227289 GTAGCTAGTGAGGTTGCAGATGG - Intronic
1112809064 13:103196722-103196744 GAAGCTGGAGAGCCTGCAGCAGG - Intergenic
1112855187 13:103759959-103759981 GATACTGGTGAGAATGCAGATGG + Intergenic
1114869329 14:26636831-26636853 GAAGCTATTCAGAATGAAGAAGG - Intergenic
1119751354 14:77080050-77080072 TAAGATAGTGGGAATGCGGCAGG + Intergenic
1121314773 14:92954361-92954383 GAGGCAAGTGAGAAGGCATCAGG + Intronic
1121410798 14:93746985-93747007 GGAGACAGTGAGAAAGCAGCTGG + Intronic
1125555892 15:40584355-40584377 GCAGCAACTGAAAATGCAGCTGG + Intergenic
1128949389 15:71860468-71860490 GAAGGTATTGAGAACACAGCTGG + Intronic
1129674955 15:77627499-77627521 CAAGCAAGTGAGAATGGAGGAGG + Intronic
1129766976 15:78175926-78175948 GATGCTGGTAAGAATGCAGAGGG - Intronic
1129951719 15:79597807-79597829 GCAGCTAGTGGCAAGGCAGCAGG - Intergenic
1130883638 15:88075684-88075706 GAAGCAAGAGAAATTGCAGCTGG - Intronic
1131668316 15:94593410-94593432 GAATCTAGTGTGAATGCTTCTGG - Intergenic
1134138071 16:11693022-11693044 GAAGCTTGTGAGACTGTAGAAGG - Intronic
1135525881 16:23213207-23213229 GAAGCAAGTGAGAAGGCTGGGGG - Intronic
1137350012 16:47705449-47705471 GGAGCCAATGAGAATGCAGCTGG - Intergenic
1137521667 16:49200433-49200455 GCAGCTAGAGAGACTCCAGCTGG + Intergenic
1141012265 16:80413876-80413898 GAAGCAAGTGAGGATGGAGGAGG + Intergenic
1143114472 17:4574880-4574902 GAATCTAGTGAGTAGGCAGGGGG - Intergenic
1143694249 17:8599570-8599592 GGAGCTTGTGAAAATGAAGCAGG - Intronic
1146490017 17:33274291-33274313 CCAGCTAATGAGAAAGCAGCTGG - Intronic
1146597436 17:34182818-34182840 GAAGCCATTGGGAATGCAGGTGG - Intergenic
1148671614 17:49414819-49414841 GAAGCAGGTGAGAATGGAGGGGG - Exonic
1148960909 17:51392056-51392078 GGAGACAGTGAGAATGCTGCAGG - Intergenic
1149467527 17:56891634-56891656 GACCCTAGTGAAAATACAGCAGG - Exonic
1150186805 17:63190601-63190623 GAAGCGAGTAAGCAAGCAGCTGG + Intronic
1151357141 17:73566150-73566172 GAAGCAAGTTAGAAGGCAGGAGG - Intronic
1151496397 17:74460692-74460714 GAAGCTGGACAGAATGGAGCTGG - Intergenic
1152375274 17:79915666-79915688 GAAGCTAGTGAGGGAGCAGAGGG + Intergenic
1154763973 18:18609982-18610004 GAAGTTTCTGAGAATGCTGCTGG - Intergenic
1155991946 18:32287266-32287288 GAAGCTAGTGAAGAATCAGCAGG - Exonic
1156524437 18:37753400-37753422 GAAGGGAGAGAGAATGTAGCTGG - Intergenic
1157301930 18:46485392-46485414 GGAGCCACTGGGAATGCAGCAGG + Intronic
1157505324 18:48222181-48222203 GAGGCTAGGGAGGGTGCAGCAGG - Intronic
1161182425 19:2893290-2893312 GAATGTACTGGGAATGCAGCCGG + Intergenic
1161699250 19:5785916-5785938 GAAGGTTGTGTGCATGCAGCTGG - Intronic
1162078340 19:8204051-8204073 ATAGCTGGTGACAATGCAGCTGG + Intronic
1163054774 19:14710065-14710087 GAAGATGGTGTGAAGGCAGCAGG + Intronic
1163832321 19:19552960-19552982 TAAGCTAGGGACACTGCAGCAGG - Intergenic
1165586653 19:36922535-36922557 GGAGCCAGTGAGAAGGCACCAGG + Intronic
1166820200 19:45574506-45574528 GATTCTTGTGAGGATGCAGCAGG - Intronic
1167676215 19:50887744-50887766 GCACCCAGTGAGGATGCAGCAGG + Intergenic
1168345807 19:55649737-55649759 GAATCAAGTGAGGAGGCAGCTGG - Intronic
925274813 2:2641243-2641265 GGAGCTGCTGAGAATGCTGCAGG - Intergenic
925550746 2:5071473-5071495 GTAGCTGGTGACAATGAAGCTGG - Intergenic
927338427 2:21952352-21952374 GAGGCCAGTGTGACTGCAGCAGG - Intergenic
931993887 2:67821619-67821641 GAAGCCAGTGTGACTACAGCAGG + Intergenic
935157924 2:100500131-100500153 GAAGCTGGTCATGATGCAGCAGG - Intergenic
936821561 2:116528185-116528207 GAAGCTATTGAGAAGCCAGAGGG - Intergenic
937328792 2:121009049-121009071 GAGACTAGTGAGAAGGCTGCTGG - Intergenic
937730744 2:125225376-125225398 CAAGCAAGTGAGAACTCAGCGGG - Intergenic
937856517 2:126675549-126675571 GAAGCTACTGAGAAAGAATCAGG - Intronic
939291039 2:140195107-140195129 GAATCTAGTTAGAAGGCTGCAGG + Intergenic
939371142 2:141301792-141301814 GATGTTAGTGAAAATGCTGCCGG - Intronic
939532520 2:143382160-143382182 GAAGCTAGTGACACTGAGGCTGG - Intronic
941698996 2:168583649-168583671 GAAGATAATGAGCATGAAGCAGG + Intronic
942512249 2:176715014-176715036 GGAGCAAGAGAGAGTGCAGCGGG - Intergenic
943809794 2:192170558-192170580 GAAACGAGTAAGAATGCAGCTGG + Intronic
945636772 2:212364417-212364439 GAAGCCAGGGATAATGCAACTGG + Intronic
948033481 2:234838925-234838947 GGAGCTGGTCAGGATGCAGCGGG - Intergenic
948518057 2:238518587-238518609 GAAGCTACTGAGAATCCAGCAGG + Intergenic
1169927031 20:10794213-10794235 GAAGCAAGAGAGCAGGCAGCTGG - Intergenic
1170263779 20:14442608-14442630 GAATCCAGTGTGAAGGCAGCTGG - Intronic
1171273436 20:23834575-23834597 GAAGCTGGTGAGAAGGCAGATGG + Intergenic
1171651609 20:27510228-27510250 GAAGTTTCTGAGAATGCTGCTGG - Intergenic
1173511222 20:43630238-43630260 GAAGCTGGTCAGACTGCAACTGG - Intronic
1173878794 20:46394984-46395006 GAAGCAAGAGAGCATGTAGCTGG - Intronic
1174673318 20:52329086-52329108 AAACTTAGTGAGAAAGCAGCAGG + Intergenic
1176136206 20:63523082-63523104 GAAGCTGGTGGGAAGGCATCTGG + Intergenic
1176894518 21:14360966-14360988 GAAGCTACTGAGATTTCAGAGGG + Intergenic
1177620158 21:23580184-23580206 GAAGGAAGTGAGACAGCAGCAGG + Intergenic
1178589586 21:33898276-33898298 GAAGACAGTGAGGATGCATCAGG - Exonic
1181322625 22:22020014-22020036 GAAGAAACTGAGAATGCTGCTGG + Intergenic
1182136680 22:27911057-27911079 GAAGCTAGTAAGAATGAGACTGG - Exonic
1183230665 22:36580041-36580063 GAACCCAGTGAGCATTCAGCAGG - Intronic
1202725712 2_KI270715v1_random:154831-154853 GAAGCTTCTGAGAATGCTTCTGG - Intergenic
1202725842 2_KI270715v1_random:156871-156893 GAAGCTTCTGAGAATGCTTCTGG - Intergenic
1202725927 2_KI270715v1_random:158231-158253 GAAGCTTCTGAGAATGCCTCTGG - Intergenic
950095138 3:10324628-10324650 GAGGCTTGTCAGAATGCACCAGG + Exonic
950861339 3:16150007-16150029 GAAGAGAATGAGAATGCAGAAGG - Intergenic
950979000 3:17281127-17281149 GTGGCAAGTGAGAATGAAGCAGG - Intronic
953860885 3:46543270-46543292 GAAGATGGTTAGAATTCAGCAGG - Intronic
954425845 3:50442759-50442781 GCAACTACTGAGAAAGCAGCTGG + Intronic
958804414 3:98792616-98792638 GAAACTAGGGAGACTGAAGCAGG - Intronic
960029462 3:113042674-113042696 GAAGCTTATGAGAAGGCAGAAGG - Intergenic
960316849 3:116188598-116188620 GAAGCTTGTGTGAATCTAGCAGG - Intronic
961511192 3:127404808-127404830 ACAGCTAGTGAGTATGGAGCAGG - Intergenic
968467761 4:761245-761267 GACGCTGGTGAGAGCGCAGCAGG - Intronic
970593711 4:17580585-17580607 GAGGCTGGTGGGAAGGCAGCTGG - Intronic
973684930 4:53359989-53360011 CATGCTAGTGTGGATGCAGCTGG - Intronic
973797189 4:54439632-54439654 TGGGGTAGTGAGAATGCAGCTGG + Intergenic
975697099 4:77024242-77024264 GACGCAAGTGTGAATGCAGGCGG - Intronic
977888725 4:102281956-102281978 GAGCATAGTGAGAATGCGGCAGG - Intronic
980596868 4:134966219-134966241 TAACCTAGTGAGAAAGCAGCTGG + Intergenic
981457236 4:144967131-144967153 GAATCAAGTGAGAATGGAGGAGG - Intronic
988140043 5:27225755-27225777 AATGCTAGTGAAAAAGCAGCAGG - Intergenic
989930090 5:49937816-49937838 GAAGTTTGTGAGAATGCTTCTGG - Intergenic
989930977 5:49951107-49951129 GAAGTTTCTGAGAATGCATCTGG - Intergenic
992537574 5:77725195-77725217 GCAGCTAATGAGCATGCAGCTGG - Intronic
994050788 5:95359740-95359762 GAAGCTTGTTAGAATGCAGATGG - Intergenic
997970182 5:138395152-138395174 GAAAATACTGAGAAGGCAGCTGG + Intronic
998629244 5:143880258-143880280 GAAGCTGGAGAGACTGGAGCAGG + Intergenic
1000938137 5:167327971-167327993 TAAGATAGTGAGAGTGCAGATGG + Intronic
1002092490 5:176813422-176813444 GACACTTGGGAGAATGCAGCTGG + Intronic
1002308127 5:178296357-178296379 GCACCTAGTGAGGTTGCAGCAGG - Intronic
1004125088 6:12865392-12865414 GAATCTAGACAGAAGGCAGCAGG - Intronic
1005562644 6:27056413-27056435 GAAGGTGGTGAGACTGCAGAAGG - Intergenic
1006194826 6:32233102-32233124 GAAGAGAGAGAGAATGGAGCAGG - Intergenic
1006856850 6:37139759-37139781 GGAGCTTGTGAAAATGCAACAGG - Intergenic
1007617923 6:43193004-43193026 GAAGCTAGTGAAGATGCTGGTGG + Exonic
1007834292 6:44662932-44662954 GAAGCTCTTGAGTCTGCAGCTGG + Intergenic
1007939838 6:45770054-45770076 GAGGCCAGTGAGGATGCAGGGGG + Intergenic
1008033658 6:46723930-46723952 GAAGCAAGTGTGATTGCAGCAGG - Intronic
1009893051 6:69712082-69712104 GAAGTTAGGCAGAATGAAGCTGG - Intronic
1009947653 6:70358342-70358364 GAACACAGTGAGAAGGCAGCTGG + Intergenic
1012294387 6:97502605-97502627 GAGGGTAGTGAGAATGTGGCTGG + Intergenic
1013480872 6:110551501-110551523 GATGCTACTTAGAAGGCAGCTGG - Intergenic
1015733754 6:136375692-136375714 GAAACTGGTGACAATGAAGCAGG + Intronic
1016295050 6:142564964-142564986 CAAGCTAGTGAGATGGCTGCGGG - Intergenic
1016749189 6:147613802-147613824 GAAAATGGTGAGAATGCATCTGG + Intronic
1016881092 6:148912938-148912960 GAATCTTGTGAAAATGCAGTAGG + Intronic
1018960301 6:168442551-168442573 GAAGGTAGTGAGAACGCCTCTGG + Intronic
1023276316 7:38522502-38522524 GAGGGCAGAGAGAATGCAGCAGG + Intronic
1024500922 7:50104832-50104854 GAAGCTAGTGAGAATGCAGCTGG - Intronic
1027392752 7:77721943-77721965 AAAGCTAGTGAGAATACACTAGG + Intronic
1029361261 7:100090002-100090024 GAAGCTGGTGAAAATACACCAGG + Intronic
1030602212 7:111605445-111605467 GAAGCAAGAGAGAATGCAGGGGG - Intergenic
1031023395 7:116652627-116652649 GAAGCCACTGAGAAGGCAGAAGG + Intergenic
1032849777 7:135784216-135784238 AATGGTAGTGAGAATACAGCAGG - Intergenic
1034311313 7:150091213-150091235 AATGCAATTGAGAATGCAGCGGG - Intergenic
1034522100 7:151628464-151628486 GTAGTTAGGGAGACTGCAGCCGG + Intronic
1034795543 7:154009430-154009452 AATGCAATTGAGAATGCAGCGGG + Intronic
1034847876 7:154463957-154463979 CAACCTAGTGAGACAGCAGCTGG - Intronic
1038568281 8:28637865-28637887 GAAGCCAGAGTGAAGGCAGCTGG - Intronic
1039850519 8:41360937-41360959 GCAGCAAGTGAGAAGGAAGCTGG + Intergenic
1041245857 8:55887954-55887976 GAAGCCAGTGGGACTGCAGAAGG + Intronic
1044112187 8:88288651-88288673 GATGTTGGTGAGAATGCAGTAGG + Intronic
1044728278 8:95210218-95210240 GAAACAAGAGAGAAAGCAGCTGG - Intergenic
1044858766 8:96500958-96500980 GAAGCCAATGAGTATGCAGCTGG + Intronic
1045586817 8:103546841-103546863 AAAGCTGGTCAGAAAGCAGCAGG - Intronic
1047295040 8:123563208-123563230 GAGTCTAGTGAGGATGCTGCTGG + Intergenic
1048786187 8:138052896-138052918 GAAGCCAGTGAGAATGGAAGGGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1048953859 8:139517857-139517879 GAAAGTAGTGAGAATACAACAGG - Intergenic
1052873404 9:33531090-33531112 GAAGTCAGTGAGAATGCAATAGG + Intronic
1054765055 9:69036129-69036151 GAAGCCAGTGTAAATGCAACCGG - Intronic
1055224465 9:73977590-73977612 GAAGGTAATGTCAATGCAGCGGG + Intergenic
1056897294 9:90562954-90562976 GAGGCAAGTGAGATTGCAGATGG - Intergenic
1057990215 9:99761118-99761140 GAAGCTTGAGAGAATGAAGTTGG - Intergenic
1058056695 9:100455960-100455982 GAAGCTGTTGTGAGTGCAGCAGG - Intronic
1058835039 9:108853240-108853262 GAGGCTTGTGAGATTTCAGCTGG - Intergenic
1062489920 9:136800088-136800110 GAAGCTGGAGAGCATGCAGCTGG + Exonic
1187084202 X:16024781-16024803 GAATGTAGTGAGAATCCAGGAGG + Intergenic
1187158103 X:16739821-16739843 GAATCTAGTGTTAAGGCAGCAGG + Intronic
1188528751 X:31114443-31114465 GAAGAAAGTGAGAAGGCAGGAGG + Intronic
1190125883 X:47705054-47705076 GAAAATAGTGAGATTGCTGCAGG - Intergenic
1193155577 X:78169322-78169344 GAAGTTAGTGAAAATTCAGATGG - Intergenic
1194141075 X:90210351-90210373 GTATCTAGGGAAAATGCAGCAGG - Intergenic
1194285933 X:92010003-92010025 TAAGTTAGTGAAAATGCAACAGG - Intronic
1195496064 X:105535308-105535330 AGTGCTAGTGAGAATGCAGCAGG + Intronic
1195714619 X:107806436-107806458 GAAGGGAATGAGAATGAAGCAGG - Intergenic
1200486838 Y:3779469-3779491 GTATCTAGGGAAAATGCAGCAGG - Intergenic
1200603487 Y:5234544-5234566 TAAGTTAGTGAAAATGCAACAGG - Intronic
1201972422 Y:19812147-19812169 GCAGCTAAAGAGAATGCAGAAGG - Intergenic