ID: 1024502783

View in Genome Browser
Species Human (GRCh38)
Location 7:50130708-50130730
Sequence AGGTGTGGGGAGGCCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 7, 3: 37, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024502776_1024502783 15 Left 1024502776 7:50130670-50130692 CCACATGTACAGGGTAGCAGGCT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG 0: 1
1: 1
2: 7
3: 37
4: 337
1024502775_1024502783 16 Left 1024502775 7:50130669-50130691 CCCACATGTACAGGGTAGCAGGC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG 0: 1
1: 1
2: 7
3: 37
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024502783 Original CRISPR AGGTGTGGGGAGGCCTCCCC AGG Intronic
900136608 1:1120347-1120369 AGGGGTGGGGCGGGCACCCCAGG + Intergenic
900354174 1:2252046-2252068 ACCTGTGGGGAGGCCTCTCGGGG + Intronic
900361667 1:2292188-2292210 AGGCGTGGGGACTCCTCTCCGGG - Intronic
900586877 1:3436925-3436947 AGGTGCGAGGAGGCCTCCTTCGG - Exonic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
900655382 1:3754295-3754317 GGGTGCAGGAAGGCCTCCCCCGG - Intronic
901069122 1:6508479-6508501 GGGTCAGGGGAGGCCCCCCCAGG + Intronic
901403669 1:9031878-9031900 AGGGGTGGGAAGGCCTTGCCGGG + Intergenic
901871172 1:12140171-12140193 AGGTGTGGGCTGCCCTCCCCTGG + Intronic
901917635 1:12512165-12512187 AGGTGTGGGGGTGCTTCCCCAGG - Intergenic
902042698 1:13504315-13504337 AGGGCTGGGCAGGCCACCCCCGG - Intronic
902046464 1:13528339-13528361 AGGAGTGGGGAGGCCCACGCTGG + Intergenic
902046721 1:13530135-13530157 AGGAGTGGGGAGGCCCACGCTGG + Intergenic
902391513 1:16109795-16109817 AGGTGTAGGGAGGGAGCCCCAGG - Intergenic
902617257 1:17630542-17630564 AGGAGCGGTGGGGCCTCCCCTGG + Intronic
902990880 1:20186249-20186271 GGGTCTGGGGAGGCCCTCCCGGG - Intronic
904042961 1:27594623-27594645 AGGGGTGGAGATGCCTCCCCAGG + Intronic
904914068 1:33957056-33957078 TGGTGAGGGGAGGCCTCTCGGGG - Intronic
905284389 1:36869840-36869862 GGATGTGGGGAGGGCTGCCCAGG - Intronic
905443055 1:38006536-38006558 GGGTGTGGGGAGGCCTCTGTGGG - Intergenic
905859765 1:41342423-41342445 AGGCATGGGGTGGCCTCCTCAGG - Intergenic
907386335 1:54127960-54127982 CAGTGTGGGTTGGCCTCCCCAGG - Intergenic
907413459 1:54298249-54298271 AGGTCTGGGGAGGCCTAGCTCGG + Intronic
907458154 1:54588904-54588926 AGGTGTGTCCAGGCCTTCCCTGG - Intronic
915200151 1:154221121-154221143 CGGTGTGGGGGGGCCTACCGAGG - Intronic
915549829 1:156625483-156625505 AGGTCTGGAGAGGCCGCTCCGGG - Exonic
915597156 1:156902264-156902286 AGCTGTGGGCAGGCCCCACCTGG + Exonic
917254548 1:173100210-173100232 AGGTGTGGGGAGGCTTCATGGGG - Intergenic
919004487 1:191878523-191878545 TGAGGAGGGGAGGCCTCCCCAGG - Intergenic
919928982 1:202208959-202208981 AGGTGTCAGAAGGGCTCCCCAGG - Intronic
920340863 1:205274381-205274403 AGGTGGGGGGTGGCTGCCCCAGG + Intergenic
923391223 1:233515622-233515644 AGGTGTGGCGAGGTCACTCCAGG + Intergenic
1063096782 10:2915575-2915597 AGCTGGGAGGAAGCCTCCCCCGG + Intergenic
1063147497 10:3309313-3309335 AGGTGTTTTGAGTCCTCCCCTGG + Intergenic
1063173368 10:3529744-3529766 AGGAGGGAGGAGGACTCCCCAGG - Intergenic
1065572028 10:27080944-27080966 AGGTGAGGGGACACCTGCCCTGG + Intronic
1067449021 10:46369950-46369972 ATGTGTGGGGAGGCCCAGCCAGG + Intronic
1067588348 10:47490815-47490837 ATGTGTGGGGAGGCCCAGCCAGG - Intronic
1067635473 10:47998906-47998928 ATGTGTGGGGAGGCCCAGCCAGG - Intergenic
1068279978 10:54855187-54855209 AGGGCAGGGGAGGCCTTCCCAGG + Intronic
1069834539 10:71300482-71300504 AGGGGAGGGGAGTCCTCCACGGG + Exonic
1070132035 10:73662914-73662936 ATGTGTGGGGAGGCCCAGCCAGG - Intronic
1070321939 10:75360949-75360971 GGGTGTGGGGAGACCTCTCCTGG + Intergenic
1070329118 10:75405464-75405486 AGGGGTGGGGAGGCCCCCGGGGG - Intergenic
1070370158 10:75774959-75774981 AGGTGTGGGGGAGGATCCCCTGG + Intronic
1071600169 10:86955135-86955157 AGGGGTGGGGACGCCTCCCAGGG - Intronic
1071609650 10:87021162-87021184 ATGTGTGGGGAGGCCCAGCCAGG + Intronic
1074720145 10:116257092-116257114 TGGTGTTAGGAGGCCTCCCCTGG - Intronic
1075703217 10:124482755-124482777 AGGTCAGGGGAGGCCTCCCTGGG - Intronic
1075737798 10:124674744-124674766 AGATGTGGTGAGGCCTCAGCTGG + Intronic
1076377843 10:130003413-130003435 AGGTGTCTGGAGGCCAGCCCCGG - Intergenic
1076486682 10:130824788-130824810 AGGAGTGGGGAGGCCTCCCCTGG - Intergenic
1076668414 10:132105591-132105613 AGGCGTGGGTAGCCCACCCCAGG - Intronic
1076670047 10:132115395-132115417 GGCTGTGCGGAGGCCTCCTCTGG - Intronic
1076745480 10:132510597-132510619 CCCTGTGGGGAGGCCACCCCAGG - Intergenic
1076787113 10:132756017-132756039 AGCTCTGGGGATGCCTCCCTGGG - Intronic
1077107534 11:848559-848581 AGGTCTGGGGAGGGCTGCCGTGG - Intronic
1077156297 11:1093216-1093238 AGGTGTGAGGGGGCCTGCCCTGG + Intergenic
1077201368 11:1309208-1309230 AGCTTTGGGGAGGCAGCCCCGGG - Intronic
1077303336 11:1856980-1857002 AGGTGTAGGGAGGGAGCCCCAGG - Intronic
1077549341 11:3193166-3193188 GGGTGTGGGCAGGTCTGCCCTGG + Intergenic
1079357924 11:19745461-19745483 AGGTGTGTGGAGGGCTACTCTGG - Intronic
1080690132 11:34549492-34549514 TGGTGTGGGGAGGCATGCCGGGG + Intergenic
1081675139 11:44964193-44964215 AGAGGTGGGGAGGCCTGGCCAGG - Intergenic
1081933115 11:46886258-46886280 AGGTATGGGAAGCCCTTCCCTGG + Intronic
1082963822 11:58945257-58945279 AGGTGGGGAGGGGTCTCCCCAGG + Intronic
1083752069 11:64766312-64766334 AGGGGTGGGCAGGACTACCCTGG + Intronic
1083900466 11:65640939-65640961 CGGTGTGGGGAGCCCTCGGCGGG + Exonic
1084557109 11:69881814-69881836 AGGAGCTGGGAGGCCTCGCCTGG - Intergenic
1084574409 11:69979584-69979606 AGATGTAGGGAGGAGTCCCCAGG - Intergenic
1084575508 11:69985843-69985865 GGGGGTGGGGAGGTCTGCCCGGG + Intergenic
1084731538 11:71076731-71076753 CAGGGTGGGGAGGCCTTCCCTGG - Intronic
1084952857 11:72676295-72676317 AGGTGTGACGAGGTCTCACCTGG + Intergenic
1085120781 11:73966100-73966122 AGGTGTGGGGAGGTCTGCTTAGG - Intronic
1085645531 11:78219893-78219915 AGGCCTGGGAAAGCCTCCCCAGG - Intronic
1085784527 11:79438719-79438741 AGGTGTTGGAAGGCCTTCCAGGG - Intronic
1087957621 11:104308193-104308215 AGGTGTGGGCAGGCCTCTTTGGG - Intergenic
1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG + Intergenic
1097912173 12:64982168-64982190 AGGTGTGGGAGGGAATCCCCTGG + Intergenic
1100783917 12:98059028-98059050 GGCTGTGGTGAGGCATCCCCAGG - Intergenic
1101846375 12:108366411-108366433 AGGTGTGTGGAGACCCTCCCAGG + Intergenic
1102046111 12:109831438-109831460 AGGTGTGGGAGCTCCTCCCCGGG + Intronic
1102459455 12:113091253-113091275 AGGTGTGGGGAGGCATTCCCTGG + Intronic
1102567105 12:113803912-113803934 ATGTGTGGGGATGACTCCCATGG + Intergenic
1103340119 12:120216637-120216659 AGGGGTGGCGGGACCTCCCCAGG + Intronic
1103560751 12:121792291-121792313 AGGTGGGGTGAGGCCCCACCTGG + Intronic
1103925165 12:124419770-124419792 AGATGTGGGGAGACCCCCTCTGG - Intronic
1103983951 12:124754974-124754996 AGCTGTGAGGGGGCCTCTCCAGG - Intergenic
1104897506 12:132171538-132171560 AGGAGTGGGGCTGCCTTCCCAGG - Intergenic
1105414168 13:20194146-20194168 GGGTTGGGGGAGACCTCCCCGGG - Intergenic
1106142446 13:27022592-27022614 AGCTGTGAGGAGGCAGCCCCCGG + Intergenic
1106568331 13:30906025-30906047 AGGTGGGGAGAGTCCTCCCCGGG - Intergenic
1106747617 13:32721338-32721360 AGGTGGGGGGAGCCCTCGCCCGG - Intronic
1107907375 13:45073864-45073886 AAGTTTCCGGAGGCCTCCCCAGG - Intergenic
1108518562 13:51224083-51224105 AGGAGTGGGGAGCCCCTCCCAGG - Intronic
1112802812 13:103131542-103131564 TGGCGGGGGGAGGCCTTCCCAGG - Intergenic
1113446799 13:110375139-110375161 AGGTGTGAGGATGGCTCACCGGG + Intronic
1113694331 13:112333160-112333182 AGGGATGGGGAGGCCTCCGTAGG - Intergenic
1113750868 13:112775791-112775813 AGGTGTGGGCTGGGCTTCCCTGG - Intronic
1115641011 14:35335624-35335646 AGGGGTGGGGAGGCCTTCCTGGG + Intergenic
1116126251 14:40790034-40790056 AGGTTTCCTGAGGCCTCCCCAGG - Intergenic
1117341751 14:54797869-54797891 ATGGGTGAGGAGGCTTCCCCAGG - Intergenic
1117519992 14:56541938-56541960 AGATGTGGGCAGGGCTTCCCTGG + Intronic
1118456287 14:65948044-65948066 AGGTGTGCTGAGCTCTCCCCAGG - Intergenic
1121827930 14:97026142-97026164 AGGTGAGAGGAGCCCTCCCAGGG - Intergenic
1122961534 14:105096171-105096193 TGGCCAGGGGAGGCCTCCCCTGG + Intergenic
1123039243 14:105483669-105483691 AGGTGTGAGGTGCCCTCCCGGGG - Intergenic
1123065119 14:105615014-105615036 TGGGGTTGGGAGGCCTTCCCAGG - Intergenic
1123069320 14:105634448-105634470 TGGGGTTGGGAGGCCTTCCCAGG - Intergenic
1123094364 14:105759608-105759630 TGGGGTTGGGAGGCCTTCCCAGG - Intergenic
1123987655 15:25659338-25659360 ACGGGTGGGGAGGCCTCCAGAGG - Intergenic
1124612594 15:31218146-31218168 AGGTGTCAAGAGGCCTCCCTAGG - Intergenic
1128108616 15:65062201-65062223 AGGAGTGGGCAGGCGTCTCCAGG - Intronic
1128152616 15:65372700-65372722 AGGTGTGAGGAGGCCTCTGGAGG - Intronic
1128227560 15:66012819-66012841 AAGTCTGGGATGGCCTCCCCAGG - Intronic
1128360131 15:66956122-66956144 TGGTGAGGGCAGGCCCCCCCAGG - Intergenic
1129656053 15:77526496-77526518 AGATGGGGGAAGGCCTCCACTGG - Intergenic
1130059607 15:80560008-80560030 ATGTGTGGGGAGGGCTCTCCTGG - Intronic
1130370937 15:83284751-83284773 AGGGGCGGAGAGGCGTCCCCGGG - Intergenic
1131061815 15:89409223-89409245 CGATGTGGGGAGGCCTGCGCGGG + Intergenic
1132591514 16:728253-728275 AGGGGCGGGGAGGGCGCCCCGGG + Intronic
1134041653 16:11073402-11073424 AGGTGTGGAGAGGCCAGACCAGG - Intronic
1134094052 16:11407179-11407201 AGGTGTGTGGAGGTCAGCCCAGG - Exonic
1134439608 16:14290948-14290970 AGGTGTGGCGAAGCCTTCGCAGG - Intergenic
1134603097 16:15548965-15548987 AGGGCAGGGGAGGCTTCCCCGGG + Intronic
1137617392 16:49855928-49855950 AGGTCCGGGGCGGCCTCCCTTGG + Intronic
1138345288 16:56316674-56316696 GGGAGTGGGGAGGCCACCCCAGG - Intronic
1138507175 16:57484208-57484230 AGGGGTGGGGAGGCCCAGCCAGG - Intronic
1139339234 16:66257128-66257150 AGGTGTGGTGAGGGCTGCCTGGG - Intergenic
1139649871 16:68356852-68356874 GGGGGCAGGGAGGCCTCCCCAGG - Intronic
1139846872 16:69927549-69927571 TGCTGTGTGGAGGCCTCCCAAGG - Intronic
1140272938 16:73482531-73482553 AGGTCTCGGGAAGCCTCTCCAGG + Intergenic
1140457627 16:75114266-75114288 AGGTCTGGGCTGGCCTCCCTCGG + Intronic
1141178791 16:81738518-81738540 AGGGCTGGGGAGGCCACCGCGGG + Intergenic
1141716230 16:85728629-85728651 AGGTGTGCGGGGGCCTCTGCAGG - Intronic
1142072234 16:88097499-88097521 AGGTGGGAAGAGGCCTCCCCAGG + Intronic
1142223565 16:88866632-88866654 AGTGGAGGGGAGGCCTCGCCTGG - Intronic
1142371653 16:89686248-89686270 AGGTGGGGGGGGGGTTCCCCAGG - Intronic
1143785247 17:9250856-9250878 GGGTGTGGCCAGGCCCCCCCAGG + Intronic
1143890591 17:10099287-10099309 TGTTTTGGGGAGGGCTCCCCAGG - Intronic
1144783400 17:17818992-17819014 AGGTGTGGAGAGGCCTGCAGGGG - Exonic
1146516793 17:33495746-33495768 AACTGTGGGGAGGCCTGCCATGG + Intronic
1146539262 17:33680432-33680454 CGGAGTGGGGTGGCCTCCCCAGG + Intronic
1146631444 17:34473156-34473178 AGGAGTGGGGAGACCTGCCCAGG - Intergenic
1147134721 17:38428374-38428396 CGGTGTGGGGGGGCCCCCCCCGG - Intergenic
1147789808 17:43006708-43006730 AGGGGTGGGGAAGCCTCGGCAGG + Intronic
1148205026 17:45774720-45774742 AGGGATGGGGAGGCCACCCCAGG - Intergenic
1151144339 17:72026979-72027001 GGGTGGGGGGAGGCCTTGCCTGG + Intergenic
1151784764 17:76270155-76270177 GGGTGTGGGGAGGCTGCCTCGGG - Intronic
1152283144 17:79397101-79397123 GGCTGTGGGGAGGCGTCTCCTGG - Intronic
1152295565 17:79465179-79465201 GGGTGAGGGGAGGCCGCCTCGGG - Intronic
1152347061 17:79759673-79759695 AGGGGTGTGGAGTCCTCCTCAGG - Intergenic
1152449828 17:80370804-80370826 AGGGCTGGGCAGGCCTCTCCTGG + Intronic
1152904255 17:82961665-82961687 AGCAGTGGGGAGGCAGCCCCGGG + Intronic
1153239220 18:3015459-3015481 AAGTGTGGAGGGGCCACCCCAGG + Intergenic
1154355439 18:13620630-13620652 AGGAGTGGTCAGGTCTCCCCTGG - Intronic
1154411610 18:14144970-14144992 AGGTGTGGGCAGGCCTGTCTGGG + Intergenic
1155498021 18:26461579-26461601 AGGAGTGGGGAAGCCTCTGCAGG + Intronic
1156560359 18:38118331-38118353 AGTTGTGGTGAGGCCTCTCCTGG - Intergenic
1158012195 18:52741763-52741785 AGGTGTGACGAGCCCACCCCAGG - Intronic
1160384731 18:78488252-78488274 GGGAGTGGAGAGGCCGCCCCAGG - Intergenic
1160816721 19:1039435-1039457 AGGCGTGGGGACGGCTCCCGCGG - Intergenic
1160835313 19:1122143-1122165 TGGTGTGGGGAGGCCTTCGAGGG - Exonic
1161227197 19:3152178-3152200 AGGTCTGGGGAGGCCTGGTCTGG + Intronic
1161347909 19:3777303-3777325 AGGAGGAGGGTGGCCTCCCCAGG + Intergenic
1161451057 19:4345667-4345689 AGGTCTGGGGAGGACCCCCCGGG + Intronic
1161602578 19:5193504-5193526 GGGTGGGGGCAGGCCTGCCCTGG + Intronic
1161921336 19:7268415-7268437 GGGTGTGGTGAGGGCTTCCCAGG + Intronic
1162011060 19:7815415-7815437 AGGGGTGGGGCAGCCTCACCAGG - Intergenic
1162011151 19:7815893-7815915 AGGGGTGGGGCAGCCTCACCAGG + Intergenic
1162084357 19:8239520-8239542 AGGCCTGGGGAGGCCTCCGCAGG + Intronic
1162450055 19:10749104-10749126 AGGTGAGGGGTGGCTTGCCCTGG + Intronic
1162520689 19:11177861-11177883 GGGTGTGGGGAGGGCTCTTCTGG - Intronic
1162782129 19:13011904-13011926 GGTGGTGGGGAGGTCTCCCCAGG + Intronic
1162921162 19:13903994-13904016 AGCTTAGAGGAGGCCTCCCCGGG - Intronic
1162921638 19:13906526-13906548 GGGGGTGGGGAGGGATCCCCAGG - Intronic
1162964502 19:14149554-14149576 GGGTGTGAAGAGGTCTCCCCCGG + Exonic
1163153533 19:15428269-15428291 AGGTGGGAGGCGGCCGCCCCGGG + Intronic
1163378117 19:16946880-16946902 AGGAGTGGGGAGGCAAGCCCTGG - Intronic
1163691858 19:18742694-18742716 AGGTGCCGGGACGGCTCCCCAGG - Intronic
1165830906 19:38729744-38729766 GGGTGTGGTGAGGCATCCCAGGG - Exonic
1166251779 19:41576337-41576359 AGGTGAGGGGAGGACTCCCTGGG + Exonic
1166255261 19:41599796-41599818 AGGTGAGGGGAGGGCTCCCTGGG + Intronic
1166259303 19:41626879-41626901 AGGTGAGGGGAGGACTCTCTGGG - Exonic
1166266536 19:41688081-41688103 AGGTGAGGGGAGGACTTCCTGGG - Exonic
1166276172 19:41755701-41755723 AGGTGAGGGGAGGACTCCCTCGG + Exonic
1166406946 19:42528290-42528312 AGGTGAGGGGAGGACACCCTGGG - Exonic
1166412002 19:42561672-42561694 AGGTGAGGGGAGGACTCCTTGGG - Intergenic
1167156580 19:47742714-47742736 AGCTGTGGGGAGGCTTCCAGGGG - Exonic
1167455499 19:49595338-49595360 GGTGGTGGGGAGCCCTCCCCGGG + Exonic
1167567827 19:50267933-50267955 AGGTGAGGGAGGGCATCCCCAGG + Intronic
1168161501 19:54513201-54513223 AGGGGAGGGGAGGCCTCACTTGG + Intergenic
925166537 2:1719217-1719239 AGGTGGGTGGCTGCCTCCCCTGG - Intronic
925235211 2:2272030-2272052 GGGTGGGGCGAGGCCTCGCCAGG - Intronic
925684886 2:6459698-6459720 AGGGGTGGGGGAGCCTCCCCTGG + Intergenic
927927453 2:27023850-27023872 CTGTGTGGGGAGGCGTCCCTTGG - Intronic
928442461 2:31303657-31303679 AGGAGTGGGGTGACCCCCCCAGG + Intergenic
931345486 2:61441470-61441492 AGATGTCAGGAGGCCTCCTCTGG + Intronic
932218072 2:69979533-69979555 AGAGGTGGGGAGGCCAGCCCTGG + Intergenic
932332197 2:70904139-70904161 AGGTGTGGAGCGGCCTTCTCAGG - Intronic
932417106 2:71580166-71580188 AGGTGAGGAGAAGCCTGCCCAGG - Intronic
932573302 2:72949675-72949697 GGGGGTGGGGAGGCCTCCTGGGG + Intronic
933271270 2:80235653-80235675 AGGTGGGGGCAGGGCTCCTCTGG - Intronic
935518845 2:104078704-104078726 AGGTCAGGGGAGGCCTTCCCAGG + Intergenic
936267629 2:111022673-111022695 AGGTGTGGGCAGGACCCCCAGGG + Intronic
937949280 2:127371308-127371330 CGGCATGGGGACGCCTCCCCTGG - Intronic
938094320 2:128451703-128451725 AAGGGCGGGGAGGCCTCACCCGG - Intergenic
938339741 2:130527523-130527545 AGGTGTGCGGAGGCCAGTCCCGG - Intronic
938350095 2:130593227-130593249 AGGTGTGCGGAGGCCAGTCCCGG + Intronic
938381162 2:130837274-130837296 AGGTGCGGGGAGGCCGGCTCAGG - Intronic
941808653 2:169734271-169734293 AGGTGTGGGAAGGACGCCGCAGG - Intronic
943450922 2:188040692-188040714 AAGTGTGCTGAGGCCTCCCAAGG + Intergenic
943536775 2:189162051-189162073 AGCTCAGGGAAGGCCTCCCCTGG - Intronic
945328740 2:208514992-208515014 AGGTGAGGGGTGGGCTCCCAAGG + Intronic
947534457 2:230931983-230932005 AGGTGTGGAGTGGCCTCGACGGG - Intronic
947643062 2:231717871-231717893 AGGTGTGGGGATGCCTTTTCTGG + Intergenic
948455238 2:238101707-238101729 AGGTCTTGGGAGGCCACCTCTGG - Intronic
948465809 2:238151081-238151103 CGCTGTGGGGACTCCTCCCCGGG - Exonic
1168976486 20:1969826-1969848 AGCTGAGGGGAGGGCACCCCAGG - Intergenic
1170882778 20:20311711-20311733 AGATGTGCAGAAGCCTCCCCTGG + Intronic
1172068730 20:32240480-32240502 AGGGGTGGGGTATCCTCCCCGGG - Intergenic
1172083336 20:32358985-32359007 AGGGGTGGGGAGCGCTCCGCCGG + Intronic
1172250094 20:33473232-33473254 AGGTCAGGGAAGGCCTCCCTGGG - Intergenic
1172899942 20:38327431-38327453 AGGAGTGGGGAGACTTCCCTTGG - Intronic
1173500012 20:43546251-43546273 AGGTGTGAGGAGGGCTCACTTGG + Intronic
1175013447 20:55763780-55763802 AGGTTTTTTGAGGCCTCCCCAGG - Intergenic
1175929104 20:62485221-62485243 AGGTTTGTGGACGCCTTCCCAGG + Intergenic
1175953480 20:62596185-62596207 GTGTGTGGGGCGGCCTCTCCTGG - Intergenic
1175955363 20:62606276-62606298 AGGTGTGGGGAGGGCCCTTCTGG - Intergenic
1176070104 20:63221853-63221875 TGGTGAGGAGAGGCCTCGCCTGG + Intergenic
1178486063 21:33020787-33020809 AGGGGTGGAGGGGCCTTCCCAGG + Intergenic
1178741373 21:35205351-35205373 GGGTGTGGGGAGCTCTCTCCTGG - Intronic
1178910330 21:36668792-36668814 AGCTTTGGGGAGGCCTGTCCTGG + Intergenic
1179237575 21:39561041-39561063 TGGGGTGGGGAGGCCTTACCTGG - Intronic
1179640370 21:42743894-42743916 TGGTACGGGGAGCCCTCCCCAGG - Intronic
1180180866 21:46118188-46118210 AGGTGTGGGTGGGGCTCCCTGGG - Intronic
1180199376 21:46215449-46215471 AGGTGTGGGGCAGCCCCTCCTGG - Intronic
1180700733 22:17780282-17780304 GGGTCTGGGCAGGCCTCCCAGGG + Intergenic
1180863872 22:19104725-19104747 AGGTGTGAGCAGGCCTGCCAGGG - Intronic
1181624872 22:24116474-24116496 CGGTGGGGGGAGGCCACCCTGGG + Intronic
1181725116 22:24806160-24806182 AGGGGTGGGGCGGCCGCCTCGGG + Intronic
1183492101 22:38122202-38122224 TAGGGTGGGGAGTCCTCCCCGGG + Intronic
1183506036 22:38209464-38209486 AGGTGTGCTGGGACCTCCCCAGG + Intronic
1183669256 22:39262685-39262707 GGGGGTGGGGAGGCCTCCCCAGG - Intergenic
1183742853 22:39678236-39678258 AGGAGTGGAGGGGCCTGCCCAGG + Intronic
1184034314 22:41911238-41911260 AGATGGGGGACGGCCTCCCCCGG - Exonic
1184222691 22:43110898-43110920 AAGTGTGGGGAGCCGTGCCCAGG + Intronic
1184414074 22:44342080-44342102 AGCTGTGGGGACGCCAGCCCGGG + Intergenic
1184634682 22:45817741-45817763 AGGTGAGCAGAGGCCTCCCAGGG + Intronic
1184649930 22:45915094-45915116 AGGAGTGTGGAAGCCTCTCCTGG + Intergenic
1184688584 22:46107430-46107452 AGGTGTGCGGAGGCCTCGGTGGG - Intronic
1184747781 22:46466001-46466023 CGGTGTGGGGAGGGCGCCTCTGG + Intronic
1184818790 22:46893128-46893150 AGGAGTGGGGTGGCCTCGGCAGG + Intronic
1184860329 22:47169878-47169900 AGGTGGAGAGAGGCCTGCCCAGG - Intronic
1185181921 22:49368653-49368675 AGGAGTGGGGAGGCCAGCGCTGG - Intergenic
949414150 3:3798924-3798946 AGGTCTGCGGAGGACGCCCCCGG + Intronic
950555673 3:13694527-13694549 AGGTGTTTAGAGTCCTCCCCTGG - Intergenic
951264166 3:20547907-20547929 AGGTGGGGGGCGCCCTCGCCTGG - Intergenic
951555551 3:23917316-23917338 AGGGGTGGAGAGGCGGCCCCCGG + Intronic
952338829 3:32428221-32428243 AGGTGCTGAGAGGGCTCCCCAGG + Intronic
953423394 3:42772588-42772610 AGGTGTGGGGAGGCCGCCCACGG + Intronic
954078327 3:48197233-48197255 ATGTGTGGGGATGTCTTCCCAGG - Intergenic
954370996 3:50169537-50169559 GGGGGTGGGGAGCCCTTCCCAGG + Intronic
954610129 3:51940608-51940630 AGGTTTGGGGATCCCTTCCCAGG - Intronic
954787259 3:53102980-53103002 AGCTGTGGGGAGGCCTCATGAGG - Intronic
954795242 3:53158067-53158089 AGGAGTCTGGAGGCCTCCCAGGG + Intronic
956769142 3:72509729-72509751 AGGTGAGGGGAGGCCTCCAGTGG + Intergenic
961571772 3:127804426-127804448 AGGAGTGGGGAGTCCTACTCAGG - Intronic
962252136 3:133841929-133841951 AGTGGTGAGGAGGCCTCCCCAGG + Intronic
962404154 3:135085970-135085992 AGCTGAGGGGAGGCCTCCCCAGG + Intronic
962706405 3:138048971-138048993 AGGTGTGGGGAGACTGCCCTGGG - Intergenic
962738734 3:138348174-138348196 AGGACTGGGGAGGCGTCCCTAGG + Exonic
962746063 3:138398189-138398211 AGGTCTGGGGAGCCAGCCCCTGG + Intronic
962932852 3:140053540-140053562 ATGTGTGTGGAGGACTGCCCAGG + Intronic
963537388 3:146544893-146544915 AGCTGGGGAGTGGCCTCCCCCGG + Intergenic
965559035 3:170044518-170044540 AGGTGTGGGCAGGCCTCAGTAGG + Intronic
966274231 3:178145524-178145546 TGGTGTGTGGAGGCTTCCCAAGG - Intergenic
966911495 3:184562492-184562514 TGGGGTGGGGAGGCCGCCCCTGG + Intronic
967402883 3:189083310-189083332 AGCTGTGGTGAGGCTTCTCCTGG + Intronic
968690014 4:1985517-1985539 AGGGTTGAGGAGGACTCCCCTGG + Intronic
968918902 4:3512275-3512297 AGGTTTGGTGAGGTCTCCCGAGG + Exonic
969057414 4:4410351-4410373 ATGCGTGGCCAGGCCTCCCCTGG - Intronic
969294597 4:6262520-6262542 AGGTGTGGGGAGGCTTTGCATGG + Intergenic
969441673 4:7220717-7220739 CGCTGTGGGGTGGCCTCTCCAGG + Intronic
969535255 4:7752730-7752752 AGGTGTTGGGAGGCGTCCACTGG - Intergenic
969610951 4:8227587-8227609 AGATGTGGTCAGGCGTCCCCAGG - Exonic
969705753 4:8790313-8790335 AGGGATGTGGGGGCCTCCCCGGG - Intergenic
976102823 4:81583491-81583513 AGGTTTGGGGAACCTTCCCCTGG - Intronic
979099845 4:116599936-116599958 GGGTATGGTGAGGCATCCCCAGG - Intergenic
984352589 4:178614386-178614408 AGGTGTTTAGAGTCCTCCCCTGG - Intergenic
985684634 5:1275568-1275590 AGGGGTGTGGAGGCCTCCCCTGG - Intronic
985690879 5:1311607-1311629 ACCTGTGGGGAGCCCTGCCCTGG - Intergenic
985722614 5:1497646-1497668 AGGTGTGGAGGGGCAGCCCCAGG + Intronic
986422180 5:7596594-7596616 AGGTGTGAGGTGACCTCCCCGGG - Intronic
987074666 5:14369602-14369624 AGGTGTGGGGCAGGCTCCCTTGG - Intronic
988738490 5:34046210-34046232 AGGGGTGGGGAGGCTTCTACAGG - Intronic
988949458 5:36242121-36242143 TGGTGCGGGGAGGTCGCCCCCGG - Intronic
990525663 5:56624447-56624469 TGGAGCAGGGAGGCCTCCCCTGG + Intergenic
993744728 5:91583210-91583232 AGGTGTGCAGAGTCCTCCCCTGG + Intergenic
993995360 5:94716029-94716051 AGGTGGCGGGAGGCCAGCCCTGG - Intronic
998174533 5:139893752-139893774 GGATGTGGGGAGGTCTCCCTTGG + Intronic
998561857 5:143179539-143179561 AGGTGTGGGGAAGATGCCCCAGG - Intronic
999515968 5:152301711-152301733 AGGGCTGGAAAGGCCTCCCCAGG - Intergenic
1000659378 5:163919427-163919449 AGGGCTGGGGAGGCCTCCCCAGG - Intergenic
1001396785 5:171423507-171423529 CGGGGTGGGGGGGCATCCCCTGG + Intronic
1002294683 5:178223848-178223870 AGCTGTGGGGAGGCCTGACGGGG - Intronic
1002365044 5:178703238-178703260 AGGTGTGCGGAGGGCGCCCACGG + Intergenic
1002372093 5:178762975-178762997 AGGTGAGGAGAGGCCGACCCAGG + Intergenic
1002376811 5:178794856-178794878 AGGTGTGGGTGGGGCTTCCCAGG - Intergenic
1002549314 5:179975184-179975206 AGGGGCGGGGAGGCGTCCCAAGG + Intronic
1002694067 5:181072489-181072511 AGTTGTTGGGAGGCCTGGCCCGG - Intergenic
1002931345 6:1637210-1637232 AAGGGTGGAGAGGCCTCCCTTGG + Intronic
1003429262 6:6024007-6024029 AGGTGAGGGGAAGCCACCTCTGG + Intergenic
1003847638 6:10189873-10189895 AGGTGTTTAGAGGCCTTCCCTGG - Intronic
1004068328 6:12273159-12273181 GGGTCAGAGGAGGCCTCCCCAGG + Intergenic
1004903932 6:20218984-20219006 AGGTATGGGGAGGCAGCCCACGG + Intergenic
1005185825 6:23162346-23162368 AGGCATGGGGACCCCTCCCCTGG - Intergenic
1005835840 6:29708890-29708912 AGATGTGGGGATGCCTCCCTTGG - Intergenic
1006117122 6:31781363-31781385 AGCTGTGGGCAGGCCTGACCCGG - Intronic
1007116643 6:39347876-39347898 GGGTGAGGGGGGGCTTCCCCAGG - Intronic
1007384344 6:41510544-41510566 AGGTGTGGGGAGGGCACACCGGG - Intergenic
1008577375 6:52874030-52874052 AGATGTGGGGCTGCCTCTCCGGG + Intronic
1010165811 6:72914007-72914029 AGGTGTAGGGAGGGCACCTCTGG + Intronic
1010707087 6:79127805-79127827 AGGGGTGGGGAGGCCCCTGCTGG - Intergenic
1011640954 6:89415368-89415390 ATGTCTGGGGATGTCTCCCCAGG + Intergenic
1011712100 6:90065380-90065402 TGGTCTGGGGAGGCCTCCCCTGG - Intronic
1014163610 6:118198804-118198826 AGGTGTTTAGAGTCCTCCCCTGG - Intronic
1017477295 6:154810730-154810752 AGGTGTGGGGAGGGTTCACTTGG + Intronic
1017889586 6:158627575-158627597 AGCTGTGGGGTGGCTGCCCCAGG + Intronic
1018065039 6:160118781-160118803 ACTAGTGGGGAGGCCTTCCCAGG + Intergenic
1018338077 6:162817197-162817219 TGGTCTGGGGATCCCTCCCCAGG + Intronic
1018758736 6:166872200-166872222 AGGTGTAGAGAGGGGTCCCCTGG - Intronic
1018816758 6:167338766-167338788 TGGTGTTGGGCGGCCTCGCCTGG - Exonic
1019349997 7:550127-550149 AGGGGTGGGGTGGGCCCCCCAGG + Exonic
1022638944 7:32163256-32163278 TGGTGTGGGGTAGCGTCCCCTGG - Intronic
1023887744 7:44373350-44373372 AGGTGTGGAGAGCCCTCACAGGG - Intergenic
1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG + Intronic
1025198014 7:56946987-56947009 AGGTGTGCGGAGCCCACCCAGGG - Intergenic
1025673935 7:63629950-63629972 AGGTGTGCGGAGCCCACCCAGGG + Intergenic
1027201264 7:76065239-76065261 CGGGGTAGGGAGGCCTCCCTGGG - Intronic
1027218789 7:76201540-76201562 CGGTGTGCAGAGGCCTCGCCAGG - Intergenic
1029272126 7:99383625-99383647 ACTTTTGGGGAGGCCTTCCCTGG - Intronic
1033145304 7:138866001-138866023 TGATCTGGGGAGGGCTCCCCAGG - Intronic
1035253613 7:157612893-157612915 GGGTGTGGGGGGCCCTGCCCTGG - Intronic
1036749657 8:11435717-11435739 AGGTGTGGGGTGACTTGCCCAGG - Intronic
1037803643 8:22048273-22048295 AGGGGTGGGGAGGCGGCCCAGGG - Exonic
1039913446 8:41842670-41842692 AGATGTGGAGGGGCCTCCCGGGG + Intronic
1043417719 8:80068679-80068701 GGGTATTGGGTGGCCTCCCCTGG + Intronic
1043958478 8:86389777-86389799 AGGTGGGGGGCGGCCTCCGCCGG - Intronic
1044326966 8:90869493-90869515 ATGTGAGGGGTGGCCTCCCAAGG - Intronic
1044839222 8:96323617-96323639 AGGCCTGGGGAGCCCTCCACGGG - Intronic
1048973430 8:139657817-139657839 GCGGGTGGGGAGGCCTCTCCAGG + Intronic
1049758041 8:144319483-144319505 AGCCGTGGGCAGGCCTCCCTGGG - Intronic
1049846903 8:144807266-144807288 CCGTGTGGGGGTGCCTCCCCTGG + Exonic
1055076022 9:72215951-72215973 AGGTGTTTAGAGTCCTCCCCTGG - Intronic
1056708537 9:88971612-88971634 AGGCCTGGGGAGGCCTGGCCTGG - Intergenic
1057194901 9:93111479-93111501 AGGCGTGGGGAGGCCTCCAGGGG - Intronic
1059123450 9:111662042-111662064 AGGGCTGGGGAGGCCACCGCAGG + Intronic
1060884054 9:127138122-127138144 AAGAATGAGGAGGCCTCCCCGGG + Intronic
1060933508 9:127503311-127503333 GGGTGAGGGGAGGCCTTCCTGGG + Exonic
1061513621 9:131075959-131075981 AGGACAGGTGAGGCCTCCCCAGG + Exonic
1061578931 9:131524960-131524982 GGGTGTGGGTGGGCGTCCCCAGG + Exonic
1061767763 9:132892610-132892632 AGGTGGGAGGAGGCCTGCACAGG - Exonic
1061922241 9:133788591-133788613 AGGTGAGGGCAGGGCTCGCCCGG - Intronic
1061940983 9:133883656-133883678 AGGTGACCGGAAGCCTCCCCAGG - Intronic
1062437721 9:136554036-136554058 AGGGGTAGGAGGGCCTCCCCTGG + Intergenic
1062450781 9:136614871-136614893 TGGAGAGGGGAGGCCTTCCCAGG + Intergenic
1062474054 9:136718941-136718963 AGGGGCCCGGAGGCCTCCCCTGG - Intronic
1062547156 9:137069050-137069072 ACCGGTGGGCAGGCCTCCCCTGG + Intronic
1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG + Intergenic
1062629151 9:137455886-137455908 GGGTGTGGGGTGGACTCCCCCGG + Intronic
1185739470 X:2519359-2519381 AAGTTTGCTGAGGCCTCCCCAGG + Intergenic
1187416065 X:19094511-19094533 AGGTATGGGGATGACTCCCAAGG + Intronic
1189511408 X:41665846-41665868 AAGAGTTGGGAGGCCTACCCTGG + Intronic
1190108573 X:47575071-47575093 TAGTGTGGGGAGGCCGGCCCTGG - Intronic
1191911846 X:66160112-66160134 AGGTGTTGGGAGGACTCTCAGGG + Intergenic
1195370353 X:104166834-104166856 AGGAGTGGGAAGGGCTCCTCGGG - Exonic
1199265981 X:145826075-145826097 AGGTGTGTGGCGGCCTCTACTGG - Intergenic
1201772118 Y:17625122-17625144 GGGTGTGCTGAGGACTCCCCAGG + Intergenic
1201829437 Y:18280864-18280886 GGGTGTGCTGAGGACTCCCCAGG - Intergenic
1202330087 Y:23740712-23740734 GGGTGGGGGGAAGCCTCCACAGG - Intergenic
1202540683 Y:25929350-25929372 GGGTGGGGGGAAGCCTCCACAGG + Intergenic