ID: 1024502783

View in Genome Browser
Species Human (GRCh38)
Location 7:50130708-50130730
Sequence AGGTGTGGGGAGGCCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 7, 3: 37, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024502776_1024502783 15 Left 1024502776 7:50130670-50130692 CCACATGTACAGGGTAGCAGGCT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG 0: 1
1: 1
2: 7
3: 37
4: 337
1024502775_1024502783 16 Left 1024502775 7:50130669-50130691 CCCACATGTACAGGGTAGCAGGC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1024502783 7:50130708-50130730 AGGTGTGGGGAGGCCTCCCCAGG 0: 1
1: 1
2: 7
3: 37
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024502783 Original CRISPR AGGTGTGGGGAGGCCTCCCC AGG Intronic