ID: 1024507327

View in Genome Browser
Species Human (GRCh38)
Location 7:50172949-50172971
Sequence ATTAATACCCCCAGTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024507327_1024507332 11 Left 1024507327 7:50172949-50172971 CCTAACCCACTGGGGGTATTAAT No data
Right 1024507332 7:50172983-50173005 TATCATTTTCATTGCACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024507327 Original CRISPR ATTAATACCCCCAGTGGGTT AGG (reversed) Intergenic
No off target data available for this crispr