ID: 1024507593

View in Genome Browser
Species Human (GRCh38)
Location 7:50175389-50175411
Sequence CCAGATAAGCAGACTCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024507593_1024507599 21 Left 1024507593 7:50175389-50175411 CCAGCCAGAGTCTGCTTATCTGG No data
Right 1024507599 7:50175433-50175455 ACTCCAGGTCTACCTTCCCATGG No data
1024507593_1024507602 28 Left 1024507593 7:50175389-50175411 CCAGCCAGAGTCTGCTTATCTGG No data
Right 1024507602 7:50175440-50175462 GTCTACCTTCCCATGGTGCAGGG No data
1024507593_1024507596 6 Left 1024507593 7:50175389-50175411 CCAGCCAGAGTCTGCTTATCTGG No data
Right 1024507596 7:50175418-50175440 TCACTGTACCCAGTGACTCCAGG No data
1024507593_1024507601 27 Left 1024507593 7:50175389-50175411 CCAGCCAGAGTCTGCTTATCTGG No data
Right 1024507601 7:50175439-50175461 GGTCTACCTTCCCATGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024507593 Original CRISPR CCAGATAAGCAGACTCTGGC TGG (reversed) Intergenic
No off target data available for this crispr