ID: 1024508318

View in Genome Browser
Species Human (GRCh38)
Location 7:50182221-50182243
Sequence CCAAAGCCAATGTTGGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024508312_1024508318 3 Left 1024508312 7:50182195-50182217 CCAGGCCCAAATTCATCTCCACT No data
Right 1024508318 7:50182221-50182243 CCAAAGCCAATGTTGGCAATTGG No data
1024508310_1024508318 9 Left 1024508310 7:50182189-50182211 CCTCCTCCAGGCCCAAATTCATC No data
Right 1024508318 7:50182221-50182243 CCAAAGCCAATGTTGGCAATTGG No data
1024508313_1024508318 -2 Left 1024508313 7:50182200-50182222 CCCAAATTCATCTCCACTGTACC No data
Right 1024508318 7:50182221-50182243 CCAAAGCCAATGTTGGCAATTGG No data
1024508311_1024508318 6 Left 1024508311 7:50182192-50182214 CCTCCAGGCCCAAATTCATCTCC No data
Right 1024508318 7:50182221-50182243 CCAAAGCCAATGTTGGCAATTGG No data
1024508314_1024508318 -3 Left 1024508314 7:50182201-50182223 CCAAATTCATCTCCACTGTACCA No data
Right 1024508318 7:50182221-50182243 CCAAAGCCAATGTTGGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024508318 Original CRISPR CCAAAGCCAATGTTGGCAAT TGG Intergenic
No off target data available for this crispr