ID: 1024512942

View in Genome Browser
Species Human (GRCh38)
Location 7:50217300-50217322
Sequence CCTGGACCTGTGATATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024512932_1024512942 28 Left 1024512932 7:50217249-50217271 CCCAGCTTGGCTCCTAACTTGTG No data
Right 1024512942 7:50217300-50217322 CCTGGACCTGTGATATGAGGAGG No data
1024512933_1024512942 27 Left 1024512933 7:50217250-50217272 CCAGCTTGGCTCCTAACTTGTGG No data
Right 1024512942 7:50217300-50217322 CCTGGACCTGTGATATGAGGAGG No data
1024512935_1024512942 16 Left 1024512935 7:50217261-50217283 CCTAACTTGTGGACTGTGTCTTG No data
Right 1024512942 7:50217300-50217322 CCTGGACCTGTGATATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024512942 Original CRISPR CCTGGACCTGTGATATGAGG AGG Intergenic
No off target data available for this crispr