ID: 1024513647

View in Genome Browser
Species Human (GRCh38)
Location 7:50223705-50223727
Sequence CAGTGCCAACATTATTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024513644_1024513647 17 Left 1024513644 7:50223665-50223687 CCAGAAATAAAACCATTCATAGT No data
Right 1024513647 7:50223705-50223727 CAGTGCCAACATTATTCATTTGG No data
1024513646_1024513647 5 Left 1024513646 7:50223677-50223699 CCATTCATAGTCAATTGGTTGTA No data
Right 1024513647 7:50223705-50223727 CAGTGCCAACATTATTCATTTGG No data
1024513643_1024513647 18 Left 1024513643 7:50223664-50223686 CCCAGAAATAAAACCATTCATAG No data
Right 1024513647 7:50223705-50223727 CAGTGCCAACATTATTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024513647 Original CRISPR CAGTGCCAACATTATTCATT TGG Intergenic
No off target data available for this crispr