ID: 1024516678

View in Genome Browser
Species Human (GRCh38)
Location 7:50265294-50265316
Sequence TGCAAAAATGCCAAAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024516671_1024516678 11 Left 1024516671 7:50265260-50265282 CCTACCTCTACCTACAACGTGTG No data
Right 1024516678 7:50265294-50265316 TGCAAAAATGCCAAAGGGGCAGG No data
1024516674_1024516678 1 Left 1024516674 7:50265270-50265292 CCTACAACGTGTGAATGTGGAGT No data
Right 1024516678 7:50265294-50265316 TGCAAAAATGCCAAAGGGGCAGG No data
1024516672_1024516678 7 Left 1024516672 7:50265264-50265286 CCTCTACCTACAACGTGTGAATG No data
Right 1024516678 7:50265294-50265316 TGCAAAAATGCCAAAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024516678 Original CRISPR TGCAAAAATGCCAAAGGGGC AGG Intergenic
No off target data available for this crispr