ID: 1024518745

View in Genome Browser
Species Human (GRCh38)
Location 7:50284334-50284356
Sequence TGGCAGCTCTAGAACCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024518742_1024518745 -8 Left 1024518742 7:50284319-50284341 CCCTGTATAAGAAAATGGCAGCT No data
Right 1024518745 7:50284334-50284356 TGGCAGCTCTAGAACCTTGGAGG No data
1024518741_1024518745 -4 Left 1024518741 7:50284315-50284337 CCTACCCTGTATAAGAAAATGGC No data
Right 1024518745 7:50284334-50284356 TGGCAGCTCTAGAACCTTGGAGG No data
1024518743_1024518745 -9 Left 1024518743 7:50284320-50284342 CCTGTATAAGAAAATGGCAGCTC No data
Right 1024518745 7:50284334-50284356 TGGCAGCTCTAGAACCTTGGAGG No data
1024518739_1024518745 0 Left 1024518739 7:50284311-50284333 CCGTCCTACCCTGTATAAGAAAA No data
Right 1024518745 7:50284334-50284356 TGGCAGCTCTAGAACCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024518745 Original CRISPR TGGCAGCTCTAGAACCTTGG AGG Intergenic
No off target data available for this crispr