ID: 1024518788

View in Genome Browser
Species Human (GRCh38)
Location 7:50284591-50284613
Sequence GGCCAGCAGCATAGTGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024518788_1024518793 5 Left 1024518788 7:50284591-50284613 CCATTCCCACTATGCTGCTGGCC No data
Right 1024518793 7:50284619-50284641 AAAGCATGAGCCAGTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024518788 Original CRISPR GGCCAGCAGCATAGTGGGAA TGG (reversed) Intergenic
No off target data available for this crispr