ID: 1024518790

View in Genome Browser
Species Human (GRCh38)
Location 7:50284596-50284618
Sequence CCCACTATGCTGCTGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024518782_1024518790 11 Left 1024518782 7:50284562-50284584 CCTGCACAGGTTTGTCCCCAGTA No data
Right 1024518790 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG No data
1024518781_1024518790 12 Left 1024518781 7:50284561-50284583 CCCTGCACAGGTTTGTCCCCAGT No data
Right 1024518790 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG No data
1024518784_1024518790 -5 Left 1024518784 7:50284578-50284600 CCCAGTACTAAACCCATTCCCAC No data
Right 1024518790 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG No data
1024518783_1024518790 -4 Left 1024518783 7:50284577-50284599 CCCCAGTACTAAACCCATTCCCA No data
Right 1024518790 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG No data
1024518785_1024518790 -6 Left 1024518785 7:50284579-50284601 CCAGTACTAAACCCATTCCCACT No data
Right 1024518790 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG No data
1024518780_1024518790 13 Left 1024518780 7:50284560-50284582 CCCCTGCACAGGTTTGTCCCCAG No data
Right 1024518790 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024518790 Original CRISPR CCCACTATGCTGCTGGCCAC AGG Intergenic
No off target data available for this crispr