ID: 1024518793

View in Genome Browser
Species Human (GRCh38)
Location 7:50284619-50284641
Sequence AAAGCATGAGCCAGTCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024518784_1024518793 18 Left 1024518784 7:50284578-50284600 CCCAGTACTAAACCCATTCCCAC No data
Right 1024518793 7:50284619-50284641 AAAGCATGAGCCAGTCAGTTTGG No data
1024518788_1024518793 5 Left 1024518788 7:50284591-50284613 CCATTCCCACTATGCTGCTGGCC No data
Right 1024518793 7:50284619-50284641 AAAGCATGAGCCAGTCAGTTTGG No data
1024518787_1024518793 6 Left 1024518787 7:50284590-50284612 CCCATTCCCACTATGCTGCTGGC No data
Right 1024518793 7:50284619-50284641 AAAGCATGAGCCAGTCAGTTTGG No data
1024518789_1024518793 0 Left 1024518789 7:50284596-50284618 CCCACTATGCTGCTGGCCACAGG No data
Right 1024518793 7:50284619-50284641 AAAGCATGAGCCAGTCAGTTTGG No data
1024518783_1024518793 19 Left 1024518783 7:50284577-50284599 CCCCAGTACTAAACCCATTCCCA No data
Right 1024518793 7:50284619-50284641 AAAGCATGAGCCAGTCAGTTTGG No data
1024518785_1024518793 17 Left 1024518785 7:50284579-50284601 CCAGTACTAAACCCATTCCCACT No data
Right 1024518793 7:50284619-50284641 AAAGCATGAGCCAGTCAGTTTGG No data
1024518791_1024518793 -1 Left 1024518791 7:50284597-50284619 CCACTATGCTGCTGGCCACAGGA No data
Right 1024518793 7:50284619-50284641 AAAGCATGAGCCAGTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024518793 Original CRISPR AAAGCATGAGCCAGTCAGTT TGG Intergenic
No off target data available for this crispr