ID: 1024524409

View in Genome Browser
Species Human (GRCh38)
Location 7:50336327-50336349
Sequence CTGGTGAAGGGGCGTGCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024524403_1024524409 -6 Left 1024524403 7:50336310-50336332 CCACAGGCACGCATGTGCTGGTG 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1024524409 7:50336327-50336349 CTGGTGAAGGGGCGTGCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024524409 Original CRISPR CTGGTGAAGGGGCGTGCGTG GGG Intronic
No off target data available for this crispr