ID: 1024524549

View in Genome Browser
Species Human (GRCh38)
Location 7:50337019-50337041
Sequence CAGGATAATGCCCTAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024524549 Original CRISPR CAGGATAATGCCCTAGAAAG AGG Intronic
904255822 1:29254173-29254195 CAGGAAAATGCCCAAGCAAGTGG - Intronic
904503113 1:30929095-30929117 CAGGATGTGGCCCCAGAAAGAGG + Intergenic
906682018 1:47733821-47733843 CAGGATAAATTCCTAGAAATAGG + Intergenic
906783371 1:48592266-48592288 CAGGACTATGTACTAGAAAGAGG - Intronic
910095627 1:83518607-83518629 CAGGAGAATGACAGAGAAAGAGG + Intergenic
912220043 1:107663585-107663607 CAAGATAATTGCCTATAAAGTGG + Intronic
915544492 1:156588680-156588702 CAGGATAATTCACTTGAAACTGG + Intergenic
916911205 1:169348990-169349012 CAAGATTATACGCTAGAAAGCGG - Intronic
917247942 1:173024654-173024676 CAGGGCAATGTCCTAGAGAGAGG + Intergenic
922064920 1:222127226-222127248 CAGGATAATGGGCTAGAGAGTGG - Intergenic
923237936 1:232052590-232052612 CAGGATAATCACCTAAAAATGGG - Intergenic
1063196917 10:3752285-3752307 CAGAATGATCCCCTAGAGAGTGG + Intergenic
1063494758 10:6496576-6496598 CAGAAAAATGGCATAGAAAGTGG - Intronic
1063925796 10:10976011-10976033 CAGGTTGTTGCCCTGGAAAGGGG + Intergenic
1064168481 10:13007064-13007086 CAGGATGATGCCATCGAAAAGGG - Intronic
1064528291 10:16281279-16281301 CTGGGAAATGCCCTAGAAACTGG - Intergenic
1064669602 10:17697522-17697544 TAGGATAATAAACTAGAAAGTGG + Intronic
1067897561 10:50200699-50200721 CATCATTATGCCCCAGAAAGTGG + Intronic
1067951414 10:50741338-50741360 CATCATTATGCCCCAGAAAGTGG - Intronic
1068985228 10:63102008-63102030 CAGGTTTCTGCCCTAGAAACAGG + Intergenic
1073233870 10:101996581-101996603 GAGGATAGTGCCATAGAAACTGG - Intronic
1074020205 10:109574741-109574763 CTGAATAATACCCTGGAAAGGGG - Intergenic
1078742689 11:14081916-14081938 CAGAAGAATGAACTAGAAAGAGG - Intronic
1079284974 11:19120467-19120489 CAGGCTCAGGCCCTAGAAACTGG - Intronic
1081201649 11:40223422-40223444 GAGGATCATGACATAGAAAGAGG - Intronic
1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG + Intronic
1087041270 11:93802753-93802775 CATGATTATGCCCTAAAAACTGG + Intronic
1088200612 11:107329462-107329484 CAGGGTAATGCGCTAATAAGTGG - Intronic
1088558433 11:111087220-111087242 CACAATAATGACCAAGAAAGAGG + Intergenic
1089759358 11:120711707-120711729 CAGGATGATCCAATAGAAAGAGG + Intronic
1090018477 11:123106492-123106514 CAGCATGATGCAATAGAAAGAGG + Intronic
1090925279 11:131244169-131244191 TAGGAGACTGCCCTAGAAGGTGG - Intergenic
1092495359 12:8988140-8988162 CAGGATAATTCACAAGAGAGAGG - Intronic
1093397811 12:18704845-18704867 CAGGCAAAAGTCCTAGAAAGTGG - Intronic
1097323173 12:58247432-58247454 CAGCATTCTGCCCTAGAAAGTGG - Intergenic
1098907549 12:76177657-76177679 AAGGAACATGCCCTAGAAACAGG + Intergenic
1099490820 12:83285967-83285989 CAGGATAAAGGCATAGAAAGTGG + Intergenic
1099542993 12:83937678-83937700 CAGGAAAAATCCCTAGAAAAAGG + Intergenic
1101038514 12:100730129-100730151 CAGGATAGAGCCCTAGAGAAGGG + Intronic
1103356721 12:120327012-120327034 CTGGATACTGCATTAGAAAGGGG + Intronic
1103903853 12:124317453-124317475 CAGGGTAATGCCTGTGAAAGGGG - Intergenic
1104519612 12:129461267-129461289 CAGGAGAAGGACCCAGAAAGGGG + Intronic
1105974256 13:25459295-25459317 CAGGATGATGCCTTAGGAGGTGG + Intronic
1109700412 13:66017811-66017833 CAGGGCAATGCCCCAGACAGTGG + Intergenic
1110165607 13:72439272-72439294 CAGGATTATGGCCCAGATAGGGG - Intergenic
1110538810 13:76684511-76684533 CAGGATACTGCCTAGGAAAGTGG - Intergenic
1111524666 13:89452633-89452655 CAGGAGAAAGCCCTTTAAAGAGG - Intergenic
1111870390 13:93824884-93824906 CATGATAGTGCCTTAAAAAGTGG - Intronic
1113914167 13:113861099-113861121 CAGGAAGATGCCCCAGCAAGGGG + Intronic
1114272016 14:21106484-21106506 GAGGATAATGCACAGGAAAGCGG - Intergenic
1114511499 14:23265447-23265469 CTGGCTAATGCCCTTGAAAATGG - Intronic
1117979385 14:61327588-61327610 CAGGAAAATGCTCTCCAAAGGGG - Intronic
1118611096 14:67540751-67540773 CATCATAATGCCCTATAAGGGGG + Intronic
1125966264 15:43877859-43877881 CAGGATCATGAACTAGAAAGCGG - Intronic
1126896857 15:53267209-53267231 CAGGATAAGGGACTAGAGAGTGG - Intergenic
1127839100 15:62814672-62814694 TATGATAATTCCCTAGAAAGAGG - Intronic
1127891472 15:63255496-63255518 CAGCATAATGCCCTATAAGGGGG - Exonic
1128631101 15:69268509-69268531 CAAAATAATGCCCAAGAAGGTGG + Exonic
1128685740 15:69684186-69684208 CAGGAAGACGCCATAGAAAGTGG - Intergenic
1135101447 16:19609819-19609841 GAGGATAATGCCTTAGGCAGAGG + Intronic
1141787620 16:86212385-86212407 CATGATAATGGCCTGGACAGAGG + Intergenic
1141960990 16:87408760-87408782 CAGAAGAATACCCTAGAATGAGG - Exonic
1145839776 17:27984772-27984794 CAGGCTTATGCCCTTGAAAAGGG - Intergenic
1146516645 17:33494855-33494877 CAGGGTGATGCCCTAGACACAGG - Intronic
1146517966 17:33504047-33504069 CAGGACAATCCCCTAGGAACTGG + Intronic
1147469433 17:40645733-40645755 GAGACTAATGCCCTAGCAAGTGG - Intronic
1148873512 17:50672960-50672982 CAGGTTAATGCCCTGGAGGGAGG - Exonic
1149296465 17:55265889-55265911 CAGGATCGTTCCCTAGAACGAGG + Intronic
1150990095 17:70247445-70247467 CAGGTTAATGCCCCTGACAGAGG + Intergenic
1157024452 18:43826301-43826323 TAAGATAATACCCAAGAAAGAGG - Intergenic
1157726177 18:49965820-49965842 GAGGATGATGTCCTAGAAGGAGG + Intronic
1157884153 18:51350146-51350168 CAGGATGATGGACTAGCAAGTGG + Intergenic
1160475506 18:79182144-79182166 CAGGATCATGCTCTAGCAACAGG - Intronic
1162333231 19:10043389-10043411 CATCATAAAGCCCCAGAAAGGGG + Intergenic
1168123834 19:54271908-54271930 CAGGGGAATGCCCAAGGAAGCGG - Intronic
1168178523 19:54643627-54643649 CAGGGGAATGCCCAAGGAAGCGG + Intronic
925126529 2:1461166-1461188 CAGGATGATGCCCTGGCCAGAGG - Intronic
927063727 2:19448504-19448526 CAGGATCTTTCCCTGGAAAGGGG - Intergenic
927194087 2:20535884-20535906 CAGCCTCATGCCCAAGAAAGAGG - Intergenic
929394996 2:41512647-41512669 CATGATAATGAGCTAGAGAGAGG - Intergenic
929702073 2:44171098-44171120 GAGGATAATGTACTAGAAACTGG - Intronic
931633936 2:64325450-64325472 AAGCATATTGTCCTAGAAAGGGG - Intergenic
932202890 2:69848204-69848226 CAGGATTATGCAGTAGGAAGAGG - Intronic
935696100 2:105772362-105772384 CAGGATAAGAACCTAGAAAAAGG + Intronic
938967993 2:136405237-136405259 GAGGATGAGGGCCTAGAAAGTGG + Intergenic
940099925 2:150023335-150023357 CAGGGTAATGCCTCAGAAGGTGG - Intergenic
941253676 2:163200216-163200238 CAGAATAAAGCCCTAGAAAATGG + Intergenic
943576787 2:189639504-189639526 CAGGATAAAGGCCTAGGAACTGG + Intergenic
945186930 2:207148770-207148792 CAGTATAAGGCACTAGAGAGTGG - Intronic
945483797 2:210370740-210370762 CAGGAGAATGCTCAAGAAGGGGG + Intergenic
948698566 2:239746746-239746768 CGGGACAATGCCCTAGGAAGTGG - Intergenic
1168913413 20:1467619-1467641 CAGGATTGTGCCTAAGAAAGTGG - Intronic
1169795339 20:9456471-9456493 AAGGTTGATGCACTAGAAAGGGG + Intronic
1170417182 20:16157131-16157153 CTGGAGAATGTTCTAGAAAGAGG - Intergenic
1170717301 20:18843075-18843097 CAGAATAATGCCCTGGGAACAGG + Intergenic
1171085521 20:22235110-22235132 CAAGATGATGCACTGGAAAGAGG - Intergenic
1172992775 20:39048512-39048534 CAGGATGAGGCCATGGAAAGGGG - Intergenic
1174705564 20:52652453-52652475 CAAGGGAATTCCCTAGAAAGGGG + Intergenic
1176458351 21:6932579-6932601 TAGGATAAGGCCCTAGAAAAAGG + Intergenic
1176836524 21:13797673-13797695 TAGGATAAGGCCCTAGAAAAAGG + Intergenic
1177050166 21:16223929-16223951 CAAAATAATGCCATGGAAAGAGG + Intergenic
1181100735 22:20537201-20537223 CCGGGTAAGGCCCTAGTAAGTGG + Exonic
1181447612 22:22990123-22990145 CAGGTCATTGCCATAGAAAGGGG + Intergenic
1181754931 22:25017071-25017093 CAGGTTGTTGCCCTAGAAAGGGG + Intronic
1183484010 22:38079770-38079792 GAGGAGAATGACCTAGAGAGAGG - Intronic
1185395775 22:50587068-50587090 CAGGATACTGTCCTAGAACCAGG - Intronic
949135943 3:565715-565737 CAGGATAATAACCAAGAAAGAGG - Intergenic
949421700 3:3872796-3872818 CAGGATATTTCCCTAGCAATTGG + Intronic
951414212 3:22403248-22403270 CAGGATAATGCCCCTGAATCAGG - Intergenic
952374878 3:32757833-32757855 CAGGAAAATTCCTTTGAAAGTGG + Intronic
954916007 3:54149213-54149235 CAGGAGGATGGCCAAGAAAGGGG - Intronic
958579863 3:96004364-96004386 CAGGATAACACCATAGAGAGGGG + Intergenic
960645140 3:119872054-119872076 CAGGATCAGGCACTCGAAAGTGG + Intronic
960717706 3:120594075-120594097 CAGGTCATTGCCCTGGAAAGGGG - Intergenic
962564303 3:136641704-136641726 CTGGATCATGCACCAGAAAGAGG + Intronic
964641030 3:158910848-158910870 CAGGTTATTGCCATGGAAAGCGG + Intergenic
965162136 3:165147599-165147621 CAGAAAAATATCCTAGAAAGGGG + Intergenic
966921316 3:184613430-184613452 CAGGTTAATGACGTAGAAGGTGG + Intronic
968563446 4:1296760-1296782 CAGGATGATGCTCCTGAAAGCGG + Intronic
968988222 4:3891100-3891122 CAGGAGAATCCCTTAGAACGTGG + Intergenic
969707801 4:8821270-8821292 CCGGATAATGCCTTAGATTGAGG + Intergenic
975921192 4:79391586-79391608 CAGGATAATGTCATATTAAGTGG - Intergenic
975926100 4:79455680-79455702 CAGGATAATGCCATGGAACTGGG - Intergenic
980794050 4:137658282-137658304 CAAGATAATGCCCTCCAGAGGGG - Intergenic
981116372 4:140995478-140995500 CAGGTCATTGCCATAGAAAGCGG + Intronic
983426348 4:167588727-167588749 CAGCTTAATGACCAAGAAAGGGG + Intergenic
983469543 4:168139601-168139623 CAAGAGATTGCCCTAGAAATAGG - Intronic
984606925 4:181796447-181796469 GAGGATTCTGCCCTTGAAAGTGG + Intergenic
986638994 5:9853436-9853458 CAGGACATTGCCATGGAAAGGGG + Intergenic
987414401 5:17647882-17647904 CAGGTGGATGCCCTAGAATGAGG - Intergenic
988411113 5:30886946-30886968 CAGGCAAATGCTTTAGAAAGTGG - Intergenic
991288803 5:65010827-65010849 CATGATAATGCCAGAGAAAAGGG - Intronic
994929944 5:106169319-106169341 CACAATAATGCCAAAGAAAGAGG - Intergenic
1000402138 5:160841080-160841102 CAGGATAAATTCCTAGAAATGGG - Intronic
1001042892 5:168349464-168349486 CAGGATGAGGCCCTGGAGAGTGG - Intronic
1004956603 6:20734258-20734280 CAAGTTAATGCTCTAGAAAAGGG + Intronic
1006668110 6:35712392-35712414 CAGGAGAAAGCCCCAGAAGGGGG + Intronic
1007945427 6:45822502-45822524 AAAGATAAAACCCTAGAAAGAGG - Intergenic
1009462034 6:63925173-63925195 CATTAAAATGCCCTAGTAAGGGG + Intronic
1012992265 6:105938193-105938215 CAGGATAATGGCATGGAAGGTGG - Intergenic
1014290994 6:119558632-119558654 CAGGATAATGCTCTATCAAGAGG - Intergenic
1017166704 6:151414927-151414949 CAGGATATTTTCCTAGAAATAGG - Intronic
1024524549 7:50337019-50337041 CAGGATAATGCCCTAGAAAGAGG + Intronic
1027127393 7:75566517-75566539 CAGGTTATTGCCATGGAAAGGGG + Intronic
1028361922 7:89978587-89978609 TAGTATAATGTCATAGAAAGTGG + Intergenic
1034049868 7:147971170-147971192 CAGGGTAATGAACTACAAAGTGG - Intronic
1035577343 8:716243-716265 CAGGGTGATGCCCTGGAGAGAGG - Intronic
1036076905 8:5512435-5512457 CAGGATAATCCAGGAGAAAGAGG - Intergenic
1037060743 8:14506414-14506436 TAGGATAATACCGTAGAGAGGGG - Intronic
1037083475 8:14817196-14817218 CAGGATAACGCCATAGAGAGGGG + Intronic
1038490914 8:27970455-27970477 CAGGTTATTGCCATAGAAAGGGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1040775802 8:51042126-51042148 CAGGATCATGTCATAGAAACAGG + Intergenic
1042848538 8:73192325-73192347 CAGGATGATGCACTGAAAAGAGG - Intergenic
1044500582 8:92950618-92950640 CAGGCTATTGCTCTAGTAAGAGG - Intronic
1045257830 8:100544636-100544658 CAAGATAGTGCCTTAGAAAATGG - Intronic
1046707277 8:117468962-117468984 CAGGATAATGTTGTGGAAAGGGG - Intergenic
1050987322 9:12100066-12100088 GAGGACAATACCCTAGAAAATGG + Intergenic
1051434330 9:17014892-17014914 CAAGATAAAGTGCTAGAAAGAGG - Intergenic
1051535678 9:18154838-18154860 CAAGAAAATGCCTAAGAAAGGGG - Intergenic
1053109870 9:35449334-35449356 GAGGATAAAGCCCTAGAGAAAGG - Intergenic
1057254011 9:93528656-93528678 ATGGATAATGACATAGAAAGAGG - Intronic
1059812261 9:117868638-117868660 CTGTATAATGCCTCAGAAAGAGG + Intergenic
1061129648 9:128701792-128701814 TAGGGTAAAGCCCTAAAAAGTGG + Intergenic
1062391930 9:136337324-136337346 CAGGGCCATGCCCTGGAAAGAGG - Intronic
1196844376 X:119887000-119887022 CAGGGAGATGCCCTAGATAGGGG - Intergenic
1201897397 Y:19006503-19006525 CAGGATCATGCTCTAGTAATAGG + Intergenic