ID: 1024524734

View in Genome Browser
Species Human (GRCh38)
Location 7:50338406-50338428
Sequence CTTTCAACACAGATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024524734 Original CRISPR CTTTCAACACAGATGGAACA AGG (reversed) Intronic
901836393 1:11926452-11926474 CTTTTACGACAGATGGAAAACGG + Intergenic
902753039 1:18530743-18530765 CTTTGAACACAGATGGGCAATGG + Intergenic
904831387 1:33308125-33308147 CTTTCAACTTAGATGGGGCAGGG + Intronic
905499802 1:38427416-38427438 GGTCCCACACAGATGGAACACGG - Intergenic
905988022 1:42305560-42305582 TTTTCAACATGGATGGAACTGGG + Intronic
908778885 1:67670104-67670126 CTTTCAAATCAGATGGATGAAGG + Intergenic
910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG + Intergenic
911048832 1:93652159-93652181 CTTTCAGAACAGAATGAACAAGG - Intronic
911849547 1:102799884-102799906 ACATCAACAGAGATGGAACATGG + Intergenic
914784462 1:150816114-150816136 CTCTCAACAAAGATGGAAATTGG + Intronic
916941813 1:169685202-169685224 GGTCCCACACAGATGGAACATGG - Intronic
918146499 1:181760759-181760781 CTTTGAAGTCAGATAGAACAGGG - Intronic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
919765088 1:201122017-201122039 GTTTCAACACTGATGGGAGAAGG + Intronic
920587288 1:207178811-207178833 CCTGCCACACAGATGGCACATGG + Intergenic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG + Intronic
923730406 1:236544377-236544399 CTTTCAAGAAGGAAGGAACACGG + Intronic
924771157 1:247080640-247080662 CTCTCAAAACATATGGTACAAGG - Intergenic
1062949042 10:1482807-1482829 CCTAGAACACAGATGGAAGAAGG - Intronic
1063172170 10:3518585-3518607 CTTTAAAAAAAGATGGGACAGGG - Intergenic
1065203342 10:23334886-23334908 CTTTCAAAAAAGATGGAAATAGG + Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG + Intronic
1074705767 10:116128871-116128893 CTTTGTACAAAGTTGGAACAGGG + Intronic
1078351574 11:10599449-10599471 CTTCCAACACTGACGGAAAATGG + Intronic
1078926757 11:15882043-15882065 CTTTCAACTGAGAGGTAACATGG + Intergenic
1085913289 11:80854044-80854066 CTTTGAACACATATGACACAAGG + Intergenic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1087283969 11:96244145-96244167 ATTTCAAAACATCTGGAACACGG - Intronic
1087419783 11:97907398-97907420 CTTTAAACACAGATGTCAGAAGG + Intergenic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1089656480 11:119950663-119950685 CTTTCATCAGAGATGGCAGAAGG + Intergenic
1090841554 11:130493115-130493137 CTTTCAAAACAGAAAGAACCAGG - Intergenic
1091138058 11:133210611-133210633 ATTTCAACTTTGATGGAACAGGG - Intronic
1091602973 12:1929176-1929198 CTTCCAACACAGTGGCAACAAGG + Intergenic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1094169857 12:27480225-27480247 CTGCCAGCACAGCTGGAACAAGG - Intronic
1095204162 12:39420350-39420372 CTCTCATCACAGATGTAGCAAGG + Intronic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1098081232 12:66787626-66787648 CTTACATGACAGAAGGAACAAGG - Intronic
1098713843 12:73802983-73803005 GTAACAACACAGATGGAACTTGG - Intergenic
1098761311 12:74428651-74428673 ATAGCAACACAGATGGAATAAGG + Intergenic
1099037987 12:77613988-77614010 CTTTCAACACATATGGATGTGGG + Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1103664157 12:122548618-122548640 CATTCAACAGAGTTGGAATATGG + Intronic
1104147397 12:126048519-126048541 CTTACAACATAGATGAAGCAAGG + Intergenic
1104154032 12:126113497-126113519 TTTTCACCTTAGATGGAACAAGG + Intergenic
1104381513 12:128311983-128312005 CTTTCAGCACAGCTGGAAGTTGG - Intronic
1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG + Intronic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109527491 13:63596119-63596141 CTTTCATCAGAGAGGGGACATGG + Intergenic
1109555997 13:63976419-63976441 CTTCCAACTTAGTTGGAACATGG - Intergenic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG + Intergenic
1112622719 13:101067935-101067957 CTTTCAAATAATATGGAACATGG - Exonic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115327556 14:32158645-32158667 GTTTCAATACATATGGGACATGG + Exonic
1115878237 14:37885472-37885494 CTTTCAACACAGAGAGCACCAGG - Intronic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1119615957 14:76099366-76099388 CACTCAACACAGGTAGAACAAGG + Intergenic
1120091543 14:80337901-80337923 CTTTCACCACACCTGGCACAGGG + Intronic
1126919332 15:53503373-53503395 CTCTTCACAGAGATGGAACATGG - Intergenic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127623994 15:60762442-60762464 CTTTCACCATAGATGGGGCAAGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1131154432 15:90066019-90066041 CTTTCAAATCAGATCGGACATGG + Intronic
1131304443 15:91229170-91229192 CTTCCAACAGAAAGGGAACATGG + Intronic
1131526165 15:93154413-93154435 CTTCCAAAACAGAGGGCACAAGG - Intergenic
1132200101 15:99945994-99946016 CTTTCAACACACACAGAAAAAGG - Intergenic
1137609818 16:49810827-49810849 CCTTCAACACAAATGGGACCTGG + Intronic
1137629158 16:49930083-49930105 CCTTCAGCACAGCTGGACCAAGG - Intergenic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1138812794 16:60170772-60170794 CTTTCAAGACAGAAGGAATACGG + Intergenic
1139127467 16:64096581-64096603 CTTTCAACACAAATCTAATAAGG + Intergenic
1143794615 17:9326694-9326716 ATTCCAACACAGAAGGGACATGG + Intronic
1144052826 17:11511749-11511771 CTTTGCACACAGAAGGAACGTGG - Intronic
1146272928 17:31496400-31496422 CTCTTAACCCAGATGGAACGGGG - Intronic
1146477107 17:33171868-33171890 CTTTCCAGGCAGACGGAACAAGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146931601 17:36782093-36782115 CTTTGGACACAGATGGGAAATGG + Intergenic
1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG + Intronic
1148197209 17:45722599-45722621 ATTTCAACACATATAGAACTTGG - Intergenic
1150640887 17:66948655-66948677 CTTACAACACACATCTAACAGGG + Intergenic
1157430287 18:47619246-47619268 ATTTCAACACATAGGTAACACGG - Intergenic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1160201774 18:76802029-76802051 CTTTCAACCCGGAAGGAACCTGG + Intronic
1161887046 19:7005159-7005181 TTTTCAACAACGATGGGACATGG + Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
925544574 2:5003316-5003338 GTTCCCACACAGATGGGACACGG - Intergenic
926043984 2:9696145-9696167 CTTTGAACACAGGTTGTACAAGG - Intergenic
929210999 2:39357033-39357055 ATTATAACACAGTTGGAACAAGG - Intronic
933894762 2:86800730-86800752 CTTTCAACAAAATTGGAAGAAGG + Intronic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
936069985 2:109361438-109361460 CTTTCAAAACAGAAAGAACCAGG - Intronic
936541598 2:113356119-113356141 GTTTAAACACAGATGGCCCAAGG - Intergenic
936958184 2:118044572-118044594 CTTTCCCCACAGATGTAACCAGG + Intergenic
939569929 2:143829162-143829184 ATTTCCATACAGATGGAAAAGGG + Intergenic
940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG + Intergenic
942003202 2:171671400-171671422 CTTTGAAGATAGAAGGAACACGG + Intergenic
943218334 2:185069337-185069359 CTTTAAACACAGGTGGCCCAGGG - Intergenic
944418794 2:199506362-199506384 TTTTAAACACAGTTGTAACATGG - Intergenic
944478048 2:200126985-200127007 TTTTCAACAGAGATGGCAGATGG + Intergenic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
946955072 2:224920901-224920923 TTTACTACATAGATGGAACAGGG - Intronic
947051654 2:226051129-226051151 TCTTCAACAGAGATGGGACAAGG - Intergenic
1169966578 20:11224488-11224510 CTTTCTACCCATATGGAAAAAGG - Intergenic
1171064608 20:22002324-22002346 CTTGCAACACAGAAGGATCTCGG - Intergenic
1172115160 20:32569363-32569385 TTTTGAACAGAGAAGGAACATGG + Intronic
1173881660 20:46418223-46418245 ATCTGAACACAGTTGGAACACGG - Intronic
1174140579 20:48410706-48410728 CTTTTACCACATATGGATCAGGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176312757 21:5162227-5162249 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312783 21:5162383-5162405 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG + Intergenic
1177119590 21:17123830-17123852 CATCCCACACAGATGGGACATGG - Intergenic
1177760105 21:25393579-25393601 CTTCCAAAACAGCTGGAAGATGG + Intergenic
1179158974 21:38876334-38876356 CTTTGAACACACCTGCAACAAGG - Intergenic
1179844254 21:44099569-44099591 ATTTCAATACAGATAGAACCAGG - Intronic
1179844265 21:44099647-44099669 ATTTCAATACAGATAGAACCAGG - Intronic
1179844291 21:44099803-44099825 ATTTCAATACAGATAGAACCAGG - Intronic
1183862614 22:40680730-40680752 CTTCCAAGACAGATGGCTCAGGG + Intronic
1184211390 22:43037694-43037716 TTTTCAACACAAATGGTACTTGG - Intergenic
949201497 3:1385735-1385757 CTTACAACACTGCTGGGACAGGG + Exonic
949295624 3:2519171-2519193 CTTGAAACACAGTTGGTACAAGG - Intronic
950077235 3:10195827-10195849 CTTTTGACACAGATGTCACAAGG + Intronic
953896588 3:46807887-46807909 CATTCCCCGCAGATGGAACATGG + Intronic
955928087 3:64027648-64027670 CTTGCAACACAGATAAAAAAAGG - Intergenic
958443788 3:94190126-94190148 CTTCCAACACAGATAGCACCTGG - Intergenic
958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG + Intronic
960399573 3:117179951-117179973 CTTTCAAGATAGATCAAACAGGG - Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
960916353 3:122699037-122699059 ATTTCAACATAGATGGATCTTGG + Intronic
961192116 3:124970674-124970696 CTTTCATCACTGATGAAAGACGG + Exonic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
963081729 3:141401651-141401673 CTGTCAAAACACAGGGAACATGG + Intronic
963402856 3:144823365-144823387 TTTTCAAACCAGATAGAACATGG - Intergenic
963916427 3:150862725-150862747 CTTTCCACACAGATGGACTGAGG - Intergenic
966283356 3:178262383-178262405 CTTTCAACAAACATGTAACCAGG - Intergenic
967106410 3:186258168-186258190 CATTCGACACAAATGGAAAATGG + Intronic
969951791 4:10844332-10844354 CTCTCAAGACAAATGGAAAAGGG + Intergenic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
971358450 4:25914996-25915018 CTTTCCACTCAGAAGGATCAGGG - Intronic
974484096 4:62484632-62484654 CTTTGAACCCAGCTGGATCACGG - Intergenic
976680362 4:87749047-87749069 CGTTTAAGACTGATGGAACATGG + Intergenic
979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG + Intronic
981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG + Intronic
983300254 4:165916035-165916057 CTTTCACCAAACATGAAACAAGG - Intronic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
987290690 5:16505635-16505657 CCTTCAGGACAGCTGGAACAGGG + Intronic
991446377 5:66704433-66704455 CTTTCAACAGAGATGAAGGATGG - Intronic
992544621 5:77800009-77800031 CTTTCAAAACAGAAAGCACAAGG + Intronic
993600012 5:89910789-89910811 CTTTTAACACACATAGAACTAGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996339887 5:122424971-122424993 CATTCAACAAACATAGAACAGGG + Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
1000347652 5:160328251-160328273 TTTTAAACACAGGAGGAACAGGG + Intronic
1001360560 5:171081108-171081130 CTTTAAACTCAGATGGACTAGGG - Intronic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG + Intronic
1008453731 6:51684065-51684087 CTTTCAGAATAGCTGGAACATGG - Intronic
1008522535 6:52375830-52375852 CTTTAAACACTGATGGTTCATGG + Intronic
1008745758 6:54667787-54667809 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1008768660 6:54951654-54951676 TTTTCAACAGAGATGTAAAATGG + Intergenic
1010648268 6:78420573-78420595 CTTTCAACATAGTTTGTACAAGG - Intergenic
1013275250 6:108578898-108578920 CTTGCACCACAGGTGGAACCAGG + Intronic
1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG + Intergenic
1015426146 6:133070119-133070141 CTCTCAACACAGTTGAACCAGGG + Intergenic
1016899901 6:149091077-149091099 CTATCAAGACAGATGGAGTAAGG + Intergenic
1021386606 7:20038799-20038821 ATTTCAAAACAGATGGTAGAAGG + Intergenic
1021646394 7:22793741-22793763 CTTTCCAAACTGATGAAACATGG - Intergenic
1021802069 7:24316939-24316961 CTTCCAACTCAGATGGTTCAAGG - Intergenic
1022195920 7:28067252-28067274 CTCACAACACTGATGGAGCAAGG - Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1023216262 7:37866397-37866419 CTTTCTACACACATGGAAGCCGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026420305 7:70229785-70229807 ATTTCAACACAGATTGATCCAGG - Intronic
1028002992 7:85524813-85524835 CTTTCAAAACAGATAGTAAAAGG - Intergenic
1028795264 7:94895209-94895231 CTTCCAACAGAGATGGACCCAGG - Intergenic
1030045164 7:105488837-105488859 TTTTCAACACAGAAAGAACTAGG - Intronic
1030740134 7:113099669-113099691 GTTTAAACACAGATGGACTATGG + Intergenic
1032454568 7:132063730-132063752 TTTGCAAGACAGATGGAAAAAGG + Intergenic
1032473749 7:132198449-132198471 CATGCAACACAGGAGGAACAGGG - Intronic
1034232057 7:149538105-149538127 CTTACATCACAGAAGGCACAAGG - Intergenic
1037251283 8:16897498-16897520 CTTTAACCCCAGATGAAACATGG - Intergenic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1038429118 8:27485708-27485730 CTTTCAGCAGAGAGGGGACACGG + Intergenic
1039132678 8:34285347-34285369 TTTGCAACACAGATGCAAGAAGG + Intergenic
1041978841 8:63831913-63831935 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1044245682 8:89942149-89942171 CTTACAACACAGAAGGAGCTAGG + Intronic
1046984096 8:120368561-120368583 TTTTCAACACTGTTGGAACCCGG + Intronic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1047944125 8:129858020-129858042 CTTTCAACATAGATCTACCATGG - Intronic
1048277669 8:133079229-133079251 CTTCCTACACAGATGGTACTGGG - Intronic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1056514371 9:87336124-87336146 CTTCTAGCCCAGATGGAACATGG + Intergenic
1059094288 9:111395866-111395888 CTTTGAACACACATGAAGCAAGG - Intronic
1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG + Intronic
1185519511 X:728348-728370 CCTTCAACACACAGGGAACGTGG + Intergenic
1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG + Intronic
1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG + Intergenic
1189515713 X:41711855-41711877 CTTTCAGCAGAGAGGGGACACGG - Intronic
1193191281 X:78573761-78573783 CTGTCAAAACAGGTGGTACATGG - Intergenic
1194140826 X:90206998-90207020 GTTTCAAGATAGAGGGAACAGGG - Intergenic
1195512518 X:105733893-105733915 CTTTCAACAAAAAAGTAACAAGG - Intronic
1196458525 X:115906540-115906562 CTTTAATAACAGATGGCACAGGG - Intergenic
1198157038 X:133971251-133971273 CTTTCTATACAGATAGAACAAGG - Intronic
1201538784 Y:15083707-15083729 CTGTCAACAGAGAACGAACAAGG - Intergenic