ID: 1024524978

View in Genome Browser
Species Human (GRCh38)
Location 7:50340328-50340350
Sequence TACTTCCCCCACAGGGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024524972_1024524978 1 Left 1024524972 7:50340304-50340326 CCGCAAGGCCTGCTGCCAGGAGA 0: 1
1: 0
2: 1
3: 40
4: 270
Right 1024524978 7:50340328-50340350 TACTTCCCCCACAGGGGATGTGG 0: 1
1: 0
2: 0
3: 14
4: 168
1024524973_1024524978 -7 Left 1024524973 7:50340312-50340334 CCTGCTGCCAGGAGAGTACTTCC 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1024524978 7:50340328-50340350 TACTTCCCCCACAGGGGATGTGG 0: 1
1: 0
2: 0
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024524978 Original CRISPR TACTTCCCCCACAGGGGATG TGG Intronic
901929800 1:12589909-12589931 TGTTTCCCCAACAGGGTATGTGG - Intronic
902199785 1:14824748-14824770 TACTACCCCCATAGGAGAGGAGG - Intronic
902970593 1:20045302-20045324 TACTTGCCCCCCTGGGGAGGTGG + Intronic
903390172 1:22958546-22958568 TACGTCCCTCTCATGGGATGTGG - Intronic
903396191 1:23003505-23003527 TACTTCCCGCCCAGAGGAGGTGG + Intergenic
904756615 1:32771714-32771736 TAGTTCCGCCCCAGGGCATGTGG + Exonic
905401462 1:37706700-37706722 TCCTCCCCTCACAGGGGCTGAGG - Intronic
906378550 1:45316765-45316787 TACTTGCCACTCAGGGGAGGTGG - Intergenic
906704349 1:47883983-47884005 TGCTTGACCCCCAGGGGATGTGG + Intronic
907642455 1:56204768-56204790 TACTCCCCCAACCAGGGATGTGG - Intergenic
908745996 1:67377082-67377104 TACTCCACCCAAAGGGGTTGAGG - Intronic
910002976 1:82359703-82359725 GACTTCCCACAAAGGGAATGTGG + Intergenic
912519904 1:110238167-110238189 TTCTTTCCCCACAGGTTATGGGG + Intronic
913074692 1:115331928-115331950 TCCTCGCCCCACAGGGGAGGGGG - Intronic
915123786 1:153649319-153649341 TAATTCACCCATGGGGGATGTGG + Intergenic
916919616 1:169450203-169450225 TCCTTCCCCTACAGAGGATAAGG + Intronic
916941612 1:169683986-169684008 TACTTGCCCCCCAGGAGAGGTGG - Intronic
917277468 1:173346108-173346130 TAACTCCCTCACAGTGGATGGGG - Intergenic
918257657 1:182764219-182764241 TAATTCCCCAACAGTGAATGAGG + Intergenic
918309974 1:183278832-183278854 AATTCCTCCCACAGGGGATGAGG - Intronic
918864180 1:189873280-189873302 TGCTTCCTCCAAAGGGTATGTGG + Intergenic
919788599 1:201275794-201275816 TACTTCCCCCACACGGGGACCGG - Intergenic
920122855 1:203671922-203671944 TGCTACCCACAGAGGGGATGGGG + Intronic
920496782 1:206460520-206460542 TCCTTCCTCCTCAGGGGCTGAGG - Intronic
921221463 1:212976919-212976941 TGCTTCCCCCAGTGGGGCTGGGG - Intronic
1065365296 10:24929377-24929399 GATTTGCCACACAGGGGATGTGG - Intronic
1071748757 10:88451358-88451380 GGCTTCTCTCACAGGGGATGGGG - Intronic
1073394409 10:103206344-103206366 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1073558857 10:104480296-104480318 GACTTCCCTCACAGCTGATGGGG + Intergenic
1073669214 10:105568733-105568755 TGCTTTCCCCATAGGCGATGTGG + Intergenic
1073683363 10:105728488-105728510 TACTTGCCCCCCAGGGGAGGTGG - Intergenic
1075274308 10:121079524-121079546 TCCTGCTCCCACAGGGTATGTGG - Intergenic
1076262276 10:129076355-129076377 TCCTTCCCCCCGAGGGGACGGGG + Intergenic
1076547770 10:131257289-131257311 TGCTGCCCTCCCAGGGGATGGGG - Intronic
1078553091 11:12293822-12293844 TCCTTCCCCCAGATGGGGTGTGG - Exonic
1080681414 11:34479993-34480015 TTCTTCTCCCTAAGGGGATGAGG - Exonic
1081539253 11:44018133-44018155 TCCTTCCCCCACTGGGGCTGGGG - Intergenic
1083292214 11:61696494-61696516 TGCCTCTCCCACAGGGGAAGGGG - Intronic
1085507648 11:77069347-77069369 TAGTTCCCTCCCTGGGGATGAGG + Intronic
1085627073 11:78081755-78081777 TACTTGCCACCCAGGGGAAGTGG - Intergenic
1086556359 11:88116009-88116031 AAGTTGCCCAACAGGGGATGGGG - Intronic
1086923351 11:92612861-92612883 TACTTCAGGCACAGGGAATGGGG + Intronic
1087745214 11:101936634-101936656 TACTTCCCCCAAAAGGTATAAGG - Intronic
1090876305 11:130791650-130791672 TACTCCCCCTCCAGGGAATGAGG - Intergenic
1092101451 12:5887428-5887450 AACATCCCCCACAGTGGAAGTGG - Intronic
1093092957 12:14941932-14941954 GAGTTCCCTCAGAGGGGATGGGG - Intergenic
1096617551 12:52842535-52842557 AACTTCCCCCACAGGGCACCAGG + Intronic
1096626670 12:52900057-52900079 CTCTTCCCCCACAGGAGATCCGG - Exonic
1102227648 12:111240309-111240331 TGCTTCCCCCACAAGGGCTAGGG + Intronic
1102259887 12:111437370-111437392 CCCTTTCCCCACAGGGGAGGAGG - Intronic
1104500972 12:129285122-129285144 AACATCCCCAAGAGGGGATGTGG + Intronic
1106590390 13:31093509-31093531 GTGTTCCCCCAAAGGGGATGGGG + Intergenic
1109865150 13:68254480-68254502 TAATTCCCTCACAGGGAAAGAGG - Intergenic
1109951362 13:69504757-69504779 TGCTGCCACCACTGGGGATGGGG + Intergenic
1115442724 14:33454685-33454707 TAGTTTCACCACAGGGGATTCGG + Intronic
1115769264 14:36654140-36654162 TACCTCCTCCACAGCGGCTGTGG - Intergenic
1115835623 14:37398352-37398374 TACTTCCTTCACAGGGTCTGTGG + Intronic
1116399342 14:44486291-44486313 TGCTTCCCCCACAGAGGAAGAGG + Intergenic
1117308799 14:54501815-54501837 TACTTCCAGCAAAGGGGAAGAGG + Intergenic
1117606059 14:57430541-57430563 TGCTGCCACCACAGGGGATGAGG - Intergenic
1119248569 14:73133200-73133222 TACTTGCCACCCAGGGGAGGAGG + Intergenic
1120328786 14:83061119-83061141 CACTTCCCCCACGGGGAATGTGG - Intergenic
1121721213 14:96109912-96109934 TACTTCCCCCACAGGAACTTGGG + Intergenic
1121799653 14:96764029-96764051 TCCTTCCACCACAGGGGCTGGGG - Intergenic
1122602238 14:102927697-102927719 CACTTCTCCCTCAGGGGCTGAGG - Intronic
1122867434 14:104613620-104613642 AGCTTCCCTCACATGGGATGTGG - Intergenic
1123011257 14:105350616-105350638 TGCTTCCCCCACAGGGGGCCTGG - Intronic
1123696118 15:22880349-22880371 GTCTGCCCCCACTGGGGATGTGG - Intronic
1125490938 15:40147884-40147906 CACTTTCCCCTCATGGGATGCGG + Intergenic
1125628993 15:41132295-41132317 TACTTGCCACCCAGGGGAGGTGG - Intergenic
1126664940 15:51067601-51067623 AACATCCCCCACATGGGGTGGGG + Intronic
1126897467 15:53274620-53274642 TACTTTCCACACAGGATATGAGG - Intergenic
1128461163 15:67868808-67868830 TTCTTGCCCCTCAGGGTATGAGG - Intergenic
1128796112 15:70467920-70467942 TACTTGCCCCCTAGGGGATTGGG - Intergenic
1132014770 15:98305790-98305812 TACTTCCCCAAAAGGGGGAGGGG + Intergenic
1133196879 16:4177326-4177348 TGCTTTCACCACTGGGGATGAGG - Intergenic
1133747291 16:8696828-8696850 AGCTTCCTCCACAGGGGAAGTGG - Intronic
1135806515 16:25547582-25547604 CACTTCCTGCACACGGGATGGGG - Intergenic
1137055543 16:35744828-35744850 TACTTGCCACCCAGGGGAGGTGG + Intergenic
1138427453 16:56945558-56945580 TGCTTGCCCCAGTGGGGATGGGG - Intergenic
1139503763 16:67388751-67388773 CCCTTCCCCCACTAGGGATGTGG + Intergenic
1140184925 16:72760488-72760510 TGCTTCAGCCACAGGGGAAGGGG + Intergenic
1141455596 16:84139623-84139645 TACATCAGCCACAGGGGATAAGG + Intronic
1142671383 17:1488868-1488890 TACTGGAACCACAGGGGATGGGG + Intronic
1142786800 17:2230727-2230749 TATCTCCCCCACAGGGAAAGAGG + Intronic
1144674313 17:17152245-17152267 TACCCCTCCCACAGCGGATGAGG - Intronic
1148076860 17:44942129-44942151 TGCTCCCGCCCCAGGGGATGGGG + Intronic
1148666214 17:49376976-49376998 TACTTCCCCCAAAGGGACTTAGG + Intronic
1152433796 17:80263227-80263249 CACCTGCCCCACAGGTGATGGGG - Intronic
1157295374 18:46438334-46438356 GGCTACCCCAACAGGGGATGTGG - Intronic
1160122674 18:76144900-76144922 TCCTTCCCTCACATGGGAGGAGG - Intergenic
1160157510 18:76444737-76444759 TACCTCCCCCACGGGGGTCGGGG + Intronic
1163491267 19:17618380-17618402 TACATCCCCCACCTGGGATGGGG + Intronic
1163551842 19:17969773-17969795 AACTTCCCCAGCTGGGGATGGGG - Intronic
1163968606 19:20771353-20771375 TACTGCCCCCACTTTGGATGGGG - Intronic
1164724625 19:30457821-30457843 TACCTGCCCCACAGGGGCTCTGG + Intronic
1166905965 19:46108619-46108641 TACTTGCCACCCAGGGGAGGTGG + Intergenic
1166915205 19:46190734-46190756 TCCTTCCCCCATGGGGGGTGGGG + Intergenic
1167763080 19:51461692-51461714 TCATTTCCCCACAGGGGATCTGG - Intergenic
1167805470 19:51780711-51780733 TGCTTCTCCCACAAGGGAAGTGG - Intronic
1168012739 19:53546372-53546394 TAATTCCTCCCCAGGGGATGTGG + Intronic
925407162 2:3613297-3613319 GACTTCTTCCACAGGGGATGCGG + Exonic
926213703 2:10890547-10890569 AAATTCCCCCACAGGAGCTGAGG - Intergenic
929966010 2:46537245-46537267 CCCTGCCCCCACAGGGGCTGGGG - Intronic
930099291 2:47590592-47590614 TACTTGCCACCCAGGGGAGGTGG + Intergenic
930750912 2:54933335-54933357 CACTTCCCCCAGAGGTGATTTGG + Intronic
934040777 2:88126043-88126065 TGCTTCTCCCACATGGGAGGTGG + Intronic
939198556 2:139004215-139004237 TACTTACCCCACAGGATATATGG + Intergenic
946110329 2:217409256-217409278 TACTTCCTCCACACGGTATTGGG + Intronic
1175503515 20:59466598-59466620 TCCTTACCCCCCAGGAGATGAGG - Intergenic
1175795358 20:61767331-61767353 TGCTGCCCCCACCGGGGCTGTGG + Intronic
1176870375 21:14079024-14079046 TTCTTCCCCCGCAGGGGCTCTGG - Intergenic
1180019499 21:45112668-45112690 TACATCCCCCAAATGGGAAGTGG - Intronic
1181487264 22:23239157-23239179 TCCTTCCCACACAGGGCCTGAGG - Intronic
1182533533 22:30981883-30981905 TACTTCTCCAACAGGTTATGGGG - Intergenic
1182806262 22:33073107-33073129 TTCTTCCCCCATATGGGGTGGGG + Intergenic
1184003198 22:41690151-41690173 TAATTCCCCCACAGGAAATCAGG + Intronic
1185184726 22:49392167-49392189 TGATTCCCACCCAGGGGATGCGG + Intergenic
949268171 3:2184706-2184728 TGCATCCTCCAGAGGGGATGAGG - Intronic
950772780 3:15325435-15325457 TTCTTCCCCCACATGGCCTGAGG + Intronic
951497021 3:23340922-23340944 TACTCCCCCCACCAGGAATGAGG + Intronic
955082749 3:55673122-55673144 TCCTTCCCCCTCACGGAATGTGG - Intronic
955533622 3:59900235-59900257 GACTCACCCCACAGGGCATGAGG + Intronic
957382536 3:79451418-79451440 TACTTCACCTACAGGGGGTAAGG - Intronic
957461223 3:80523023-80523045 TACTTCACCCATAGGGGAATGGG + Intergenic
961343840 3:126248197-126248219 TACTTGCCACCCAGGGGAGGTGG - Intergenic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
966034267 3:175391504-175391526 TACTTCCCCCACTGGGTGTTTGG - Intronic
969607715 4:8210875-8210897 CCCTTCCCCCATAGGGGGTGAGG + Intronic
971442906 4:26709393-26709415 TACTTCAGCCAGAGGGGAAGGGG + Intronic
972201633 4:36719751-36719773 TACTGCCACTACTGGGGATGGGG + Intergenic
980454473 4:133021197-133021219 TCCTTGCTCCCCAGGGGATGGGG - Intergenic
982338284 4:154265846-154265868 TATATCCCCCACAGGGAAGGGGG - Intronic
984477897 4:180260218-180260240 TCCTTCCCTCACAAGGGAGGTGG - Intergenic
985619253 5:945222-945244 TTCTCCTGCCACAGGGGATGTGG + Intergenic
985723201 5:1501458-1501480 TACTTCCTCCACAGGGCCGGGGG + Exonic
985791935 5:1933525-1933547 AAATTGTCCCACAGGGGATGAGG - Intergenic
986130912 5:4929152-4929174 TCTTTCCCCCACAGGGAAAGTGG - Intergenic
986617890 5:9638793-9638815 TCCATCCCCCACAGTGGCTGTGG - Intronic
987735307 5:21833799-21833821 AACTTCCCTCACTGGGGATATGG + Intronic
989659765 5:43787284-43787306 TACTTGCCCCCCAGGGAAGGTGG - Intergenic
990273025 5:54166197-54166219 TTTTTCCCCCACAAGAGATGGGG + Intronic
992657000 5:78920624-78920646 CACCTCCACCACAGGGGATGGGG + Intronic
997441887 5:133914390-133914412 TTCTTCCCCTACAGGGAAGGAGG + Intergenic
999351043 5:150872278-150872300 TGTTGCCCCCACTGGGGATGGGG - Intronic
999818372 5:155200287-155200309 TACTTCCCTCAGAGGGTTTGTGG - Intergenic
1004469473 6:15916605-15916627 GACTTCCCTCACAGGACATGTGG + Intergenic
1005972088 6:30769447-30769469 TTCTGCCCCCACAGCGGAAGTGG - Intergenic
1006133671 6:31883247-31883269 CACTTCCCCCACAGGGTAGGAGG + Intronic
1006209089 6:32377341-32377363 TATTTTCCCCACTGGGGATAAGG + Intergenic
1007989194 6:46237702-46237724 TACTTCCACCACATAGGTTGAGG - Intronic
1009809369 6:68640343-68640365 TAGCTCCCCCACTGGGGATTGGG - Intronic
1015813915 6:137188071-137188093 TTTTTCCCCCACTGGGGATTTGG - Intergenic
1019169505 6:170124319-170124341 TTCCACCCTCACAGGGGATGCGG - Intergenic
1019619014 7:1980429-1980451 TACGTCCCCCAGAGAGGAGGCGG - Intronic
1024524978 7:50340328-50340350 TACTTCCCCCACAGGGGATGTGG + Intronic
1026931754 7:74226828-74226850 TCCTTCCCCCAGATGGGGTGAGG - Intronic
1032507035 7:132443281-132443303 AAGTTCCCCCACAGAGGACGGGG - Intronic
1038170144 8:25124038-25124060 TCCTTCCCCCAAAGGGGAGGTGG - Intergenic
1039499165 8:38003251-38003273 TACTTGCCACCCAGGGGAGGTGG + Intergenic
1040763707 8:50880877-50880899 TCCCTCCCCCACATGGGATATGG + Intergenic
1042642636 8:70953085-70953107 TACTTCTCACACAGAGGCTGAGG - Intergenic
1044302108 8:90596719-90596741 TGCTCCTCCCACAGGGGTTGAGG - Intergenic
1049591323 8:143464328-143464350 CACTGCCCCCACAGGGTCTGGGG + Intronic
1051132872 9:13882273-13882295 AACTTTCCCCACAGAGGATAAGG - Intergenic
1051677017 9:19568862-19568884 TACTTCCAGAACAGGGGCTGGGG - Intronic
1052759247 9:32572938-32572960 TGCTGCCCCCACAGAAGATGGGG - Exonic
1054721084 9:68604667-68604689 TACTTTCCCCTCAGGGAGTGGGG + Intergenic
1055397995 9:75893252-75893274 TACCTCACACACAGGAGATGAGG + Intronic
1055551973 9:77439788-77439810 TGCTTTCCCCACAGCGCATGAGG - Intronic
1056789103 9:89614052-89614074 TACTTCACCTCCAGGGGAGGTGG + Intergenic
1061554400 9:131358036-131358058 CCCTTCCCCCACAGAAGATGAGG + Intergenic
1186944890 X:14554801-14554823 TCCTTCCCCCACTGTGGAAGAGG - Intronic
1192347518 X:70323227-70323249 CACTTCCCCCAAAGCGGATTAGG + Intronic
1192454421 X:71265346-71265368 TACTTGCCACCCAGGGGAGGTGG - Intergenic
1192981981 X:76353851-76353873 CCCATCCCCCACAGCGGATGGGG + Intergenic
1194815792 X:98439912-98439934 TACATCCTCCACAGTGGCTGTGG + Intergenic
1196248317 X:113427763-113427785 TACTTCCCCCACTCTGCATGTGG - Intergenic
1197664777 X:129211692-129211714 AGTATCCCCCACAGGGGATGAGG + Intergenic
1197666026 X:129224305-129224327 TACTCCTCCCACAGAGGTTGAGG + Intergenic
1197765394 X:130056732-130056754 TTTTTCCCCCACTGGGGAGGGGG + Exonic
1201765668 Y:17571528-17571550 TTCTTCCCCCGCAAGGGCTGTGG - Intergenic
1201835884 Y:18334461-18334483 TTCTTCCCCCGCAAGGGCTGTGG + Intergenic