ID: 1024527693

View in Genome Browser
Species Human (GRCh38)
Location 7:50362792-50362814
Sequence GGTTGAGGATGATAATCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024527687_1024527693 17 Left 1024527687 7:50362752-50362774 CCATGGAAAGCTTGGAAGCAGTT 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1024527693 7:50362792-50362814 GGTTGAGGATGATAATCTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 129
1024527691_1024527693 -10 Left 1024527691 7:50362779-50362801 CCGGATAAGAGCAGGTTGAGGAT 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1024527693 7:50362792-50362814 GGTTGAGGATGATAATCTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 129
1024527686_1024527693 18 Left 1024527686 7:50362751-50362773 CCCATGGAAAGCTTGGAAGCAGT 0: 1
1: 0
2: 2
3: 13
4: 135
Right 1024527693 7:50362792-50362814 GGTTGAGGATGATAATCTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024527693 Original CRISPR GGTTGAGGATGATAATCTTA GGG Intronic
903476921 1:23625954-23625976 GGAGGAGGATGATAATGATAGGG + Intronic
903708035 1:25301433-25301455 GGTTTTGGATGAGAATCCTAGGG - Intronic
903719076 1:25390980-25391002 GGTTTTGGATGAGAATCCTAGGG + Intronic
906194306 1:43920457-43920479 GGTTGAGGATTCGAATCTCAGGG - Exonic
908902287 1:68969525-68969547 GGAAGATGATGACAATCTTAGGG - Intergenic
909922465 1:81399740-81399762 AATTAAGGATAATAATCTTAAGG - Intronic
909938948 1:81588507-81588529 GGTAGATGATGATTATGTTACGG - Intronic
917241077 1:172949414-172949436 GAGTGAGGATGATCATTTTAGGG - Intergenic
918343077 1:183583006-183583028 GTTTAAGGCTGATAATGTTATGG - Intronic
919267881 1:195295732-195295754 TGTTGAATATGATAATGTTACGG - Intergenic
920994770 1:210978801-210978823 GGTAGAGGATGAAAGCCTTATGG - Intronic
924574516 1:245267836-245267858 GGTTGTGGGTGATATTTTTAGGG + Intronic
1063552619 10:7047438-7047460 GGTTGAGGAGAATAGTCTTGGGG + Intergenic
1069342589 10:67429203-67429225 GGTTGATTTTGATAATTTTAGGG - Intronic
1069527419 10:69185239-69185261 GTTTGAGGATGATGATTTCAGGG - Intronic
1076030627 10:127154834-127154856 GGTTGATGATGAGAATTTTCTGG + Intronic
1076614689 10:131747764-131747786 GGATGAGGATGACAAGCTTGTGG + Intergenic
1077577155 11:3393014-3393036 AGTTGAAGCTGAAAATCTTAAGG + Intergenic
1084229092 11:67737797-67737819 AGTTGAAGCTGAAAATCTTAAGG + Intergenic
1084846188 11:71901899-71901921 AGTTGAAGCTGAAAATCTTAAGG - Intronic
1085835184 11:79948216-79948238 ATTTGAGGATGTTAATCTCATGG - Intergenic
1087798629 11:102480539-102480561 GGATGTGGATGTTAATTTTAAGG - Intronic
1090775589 11:129962425-129962447 GGATGAGAATGATAATGTTGAGG - Intronic
1091183268 11:133626656-133626678 GTTTGAGGATCATTATCCTAAGG + Intergenic
1092391359 12:8082733-8082755 GGATGAGGATGATAAGCTGAAGG - Intronic
1092433755 12:8429868-8429890 AGTTGAAGCTGAAAATCTTAAGG + Intergenic
1097919686 12:65058285-65058307 GGTATAGGATGATAATTATATGG + Intronic
1098663321 12:73127511-73127533 GGTACAGTATTATAATCTTAGGG - Intergenic
1100501241 12:95175859-95175881 GGGTGAGGAGGAAAAACTTATGG + Intronic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1102990598 12:117313040-117313062 GGTTGAGGATGATAACGATGAGG - Intronic
1110900284 13:80813496-80813518 GGATGAGGATGACAATGTTGAGG + Intergenic
1116660971 14:47709851-47709873 GGTTCTGGATGATATGCTTATGG + Intergenic
1117775311 14:59178037-59178059 GGTACAGTATTATAATCTTATGG + Intergenic
1117805554 14:59486478-59486500 GGTTGAGGACCTTAATCATAAGG + Intronic
1120599185 14:86480008-86480030 GGTGGAGTATGATAATTTTAGGG - Intergenic
1124230794 15:27944677-27944699 GGTTGAGGGTGTAAATCATAGGG - Intronic
1127674308 15:61226304-61226326 GGTTGAAAATGCTAATCATAAGG + Intronic
1129462522 15:75706731-75706753 GGTTGTGGATTATTATCTGATGG + Intronic
1130168718 15:81489199-81489221 AGTTGATGATGAAAATCTTGGGG + Intergenic
1131625201 15:94110584-94110606 GGTAGAGGAAGAAAACCTTAGGG - Intergenic
1131765180 15:95668265-95668287 GGCTGATGATGAAAATCTGAAGG - Intergenic
1133565697 16:6991493-6991515 GGTTGATGATAATAATCACATGG - Intronic
1138408538 16:56819457-56819479 GCTGGTGGAGGATAATCTTAAGG - Intronic
1147286614 17:39407498-39407520 GGAGGAAGATGATGATCTTATGG - Exonic
1148817957 17:50344337-50344359 TGTTAATGATGATCATCTTAAGG + Intergenic
1149037495 17:52151699-52151721 TGATGATGATGATAATTTTATGG + Intronic
1153088343 18:1315791-1315813 GGTTGAAGAAGAAAATCTTTTGG + Intergenic
1158340628 18:56462154-56462176 GCTGGAGGGTCATAATCTTAGGG - Intergenic
1163495717 19:17645548-17645570 GGTCGAGGAGCATAATCTGATGG - Intronic
1164249231 19:23462469-23462491 GTGTGAGGATGACTATCTTAAGG - Intergenic
1164325072 19:24184124-24184146 GGGTGAGGATGACTATCTTAAGG + Intergenic
1165770337 19:38376251-38376273 GGTTGGGGGTGATAATCTGGGGG + Intronic
929464256 2:42130609-42130631 GGTTGAGAATGATTGTCTTTGGG - Intergenic
930827467 2:55708899-55708921 GGTTAACGATGATAATGTAAAGG - Intergenic
932500030 2:72175096-72175118 GGATGAGGATGATGATATTTAGG + Intergenic
935793153 2:106612926-106612948 TGTTGAGGATGAGAATGTGAAGG - Intergenic
939138116 2:138321218-138321240 GGTTCATAATAATAATCTTAAGG + Intergenic
941788734 2:169527254-169527276 GTTTGAGGATGATGATGTTCTGG + Intergenic
944617430 2:201476171-201476193 TATTTAGGATGATAATCTCAAGG - Intronic
944933058 2:204540120-204540142 GGTGGAGGATGGTAAGCTTTGGG - Intergenic
946746750 2:222853952-222853974 GCTTGAGGATGATATTCTATTGG + Intergenic
1169181995 20:3577493-3577515 GGTTCAGGATGATGAACTCAGGG + Intronic
1169463624 20:5818670-5818692 GGTTGAGGTTTATAAGCATATGG + Intronic
1170633196 20:18082740-18082762 AGTTGAGGATGAAAATCAAAGGG - Intergenic
1170640781 20:18150760-18150782 GGTTAGGGATGTTAATCTTGAGG - Intronic
1170697337 20:18670984-18671006 GGTTGTGGATGACAACCTCATGG + Intronic
1175330045 20:58157277-58157299 GTTTGAGGATGATAATATCCGGG - Intronic
1176002385 20:62838416-62838438 AATTGGGTATGATAATCTTAAGG + Intronic
1179414437 21:41186872-41186894 GGATGAGGGTGGTAACCTTAGGG + Intronic
949866007 3:8548089-8548111 AATAGAGTATGATAATCTTATGG + Intronic
949963930 3:9339137-9339159 GGTTCAGAATCATAATCATATGG - Intronic
957045682 3:75372625-75372647 AGTTGAAGCTGAAAATCTTAAGG + Intergenic
957568793 3:81919194-81919216 TGTTCAGGAGGATGATCTTAAGG - Intergenic
959034286 3:101342496-101342518 GGTTGTGTATGATAAGATTAGGG - Intronic
961003871 3:123391636-123391658 GGGTGAGGATGAGAATATTTTGG - Intronic
961382369 3:126504139-126504161 AGTTGAGGATGATACACTTAGGG - Intronic
963493660 3:146033123-146033145 GTTTAGGGCTGATAATCTTATGG - Intergenic
964069312 3:152612406-152612428 GGATGCGGATGAGAGTCTTAAGG + Intergenic
964207299 3:154188721-154188743 GGTTGAGGATGACTAACTTATGG + Intronic
964832573 3:160901473-160901495 GGGTGAGGAGGAGAATTTTAGGG - Intronic
965801180 3:172496045-172496067 TTTTGAGGATGATAATCTTTGGG + Intergenic
967827266 3:193887528-193887550 GATTGGGGATGAAAATCTAAAGG - Intergenic
968989955 4:3903782-3903804 AGTTGAAGTTGAAAATCTTAAGG + Intergenic
969191828 4:5527414-5527436 AGCTGAGGATGACAAGCTTAGGG + Exonic
969787189 4:9467737-9467759 AGTTGAAGCTGAAAATCTTAAGG - Intergenic
971581057 4:28341531-28341553 AATTGGGGATTATAATCTTATGG + Intergenic
976068984 4:81220044-81220066 GGTTGGGGATGAGAGTGTTATGG + Intergenic
977428945 4:96907004-96907026 AGTTAAAGATGATAATTTTATGG + Intergenic
980826530 4:138080457-138080479 GGTTGATGATAAAAATTTTAAGG - Intergenic
982486820 4:155976354-155976376 GGTTTTGGATGAGATTCTTAGGG - Intergenic
987089234 5:14496658-14496680 GTTTGAGGATGAAAATATAAAGG - Intronic
987937724 5:24489056-24489078 GGTTGAGGATCAAAATGTTTGGG - Intronic
987947125 5:24624934-24624956 GATTGAAGATGCTAATCTTTAGG - Intronic
988851428 5:35184925-35184947 GGTTTAGAATGATAATATTTTGG + Intronic
990625321 5:57604420-57604442 TGGTGAGTATGATAATGTTAGGG + Intergenic
990873875 5:60462727-60462749 GGTAGTGAATGATCATCTTAAGG - Intronic
992512454 5:77451658-77451680 GGGTGATGGTGATTATCTTAAGG - Intronic
995533985 5:113117459-113117481 GGTTGAGGTTTATACCCTTAGGG - Intronic
997855986 5:137373294-137373316 TGTTGATCATGTTAATCTTATGG - Intronic
1000549537 5:162643143-162643165 GGTTGAAGCAGATAATCTGAGGG + Intergenic
1002958907 6:1896096-1896118 GCTTGAGGATGATTATGTAAGGG + Intronic
1004340118 6:14800933-14800955 GCTTGAGGATGAAGTTCTTAAGG - Intergenic
1004668765 6:17775535-17775557 TGTTGAGAATGATTAGCTTAAGG + Intronic
1005429020 6:25734145-25734167 GGTTTAGGGTAATAATTTTATGG - Intergenic
1008038349 6:46771108-46771130 GGTTGAGGATGATAAGGCTTGGG + Intergenic
1009654706 6:66526703-66526725 GATTTAGGATGATTATCATAGGG + Intergenic
1012268792 6:97181994-97182016 GGCTGAGGCTGAAAATCTGATGG + Exonic
1013550045 6:111198646-111198668 AGTACAGGATTATAATCTTATGG + Intronic
1013958350 6:115867434-115867456 GGGTGAGGGTGCTTATCTTAGGG - Intergenic
1016922807 6:149313089-149313111 GATTGAGGATGGTAATCTGATGG - Intronic
1017982621 6:159414626-159414648 GGTTTATGATGATAATAATAAGG - Intergenic
1020312777 7:6881837-6881859 AGTTGAAGCTGAAAATCTTAAGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021206788 7:17790043-17790065 GCTTGAGGATGATGTTCTCATGG - Intergenic
1021518904 7:21518821-21518843 TGTTGAGGAAAATAATCTAATGG + Intergenic
1024527693 7:50362792-50362814 GGTTGAGGATGATAATCTTAGGG + Intronic
1027915235 7:84309279-84309301 GGATGAGGATTAGAGTCTTAGGG + Intronic
1030384660 7:108854125-108854147 GTTTGAGGATGATAAGGTTTAGG - Intergenic
1031101980 7:117492225-117492247 GTTTTAGGATGATCATCTTTAGG + Intronic
1031619890 7:123923353-123923375 GGTTGAGCCTCATTATCTTATGG + Intergenic
1031680969 7:124674271-124674293 GAATAAGAATGATAATCTTATGG - Intergenic
1032529762 7:132610416-132610438 GGACGAGGATGAGAAGCTTAGGG - Intronic
1033935737 7:146583432-146583454 AGTTGAGCATGAGAATCTGAAGG + Intronic
1035698855 8:1622630-1622652 GTTTGTGGATGACAATCTAAGGG + Intronic
1041719459 8:60963110-60963132 GGGGGAGGATGCTAATTTTAAGG + Intergenic
1043566033 8:81548798-81548820 GGGTGGGGCTGATAATGTTAAGG + Intergenic
1043934239 8:86125146-86125168 GGTTGAGGATGTTAAGGTAATGG + Intronic
1044086009 8:87942902-87942924 GGTTGTGGATGATGAACTCAAGG - Intergenic
1047726225 8:127686280-127686302 GGGTGATGATGATGATTTTAGGG - Intergenic
1051461990 9:17329507-17329529 CTTTGAGGAAGATAATCATATGG + Intronic
1052068210 9:24049061-24049083 AGTTGTGGATGATATTCTTTGGG + Intergenic
1058217498 9:102253497-102253519 GGTTAGGGATGATAATATTTAGG - Intergenic
1186723970 X:12336930-12336952 GTTTGAATATGATAATATTAGGG + Intronic
1188091977 X:25975983-25976005 ACTTGAAGATGAAAATCTTATGG - Intergenic
1190977279 X:55417954-55417976 TCTTGGGGATGATAATCTCATGG - Intergenic
1194830470 X:98617715-98617737 TCTTGAGGATGATATTCTTGTGG + Intergenic