ID: 1024529400

View in Genome Browser
Species Human (GRCh38)
Location 7:50378876-50378898
Sequence ACCTGGGACCCTTTATATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024529400_1024529403 -5 Left 1024529400 7:50378876-50378898 CCTAAATATAAAGGGTCCCAGGT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1024529403 7:50378894-50378916 CAGGTAGATACAGAAATACCTGG No data
1024529400_1024529405 10 Left 1024529400 7:50378876-50378898 CCTAAATATAAAGGGTCCCAGGT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1024529405 7:50378909-50378931 ATACCTGGTTTGGCCAAACTTGG 0: 1
1: 0
2: 2
3: 3
4: 80
1024529400_1024529404 0 Left 1024529400 7:50378876-50378898 CCTAAATATAAAGGGTCCCAGGT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1024529404 7:50378899-50378921 AGATACAGAAATACCTGGTTTGG 0: 1
1: 0
2: 3
3: 67
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024529400 Original CRISPR ACCTGGGACCCTTTATATTT AGG (reversed) Intronic
903438732 1:23371231-23371253 ACCTGGGACCCTCTAGAGGTTGG + Exonic
904031972 1:27538885-27538907 GCCTGTGACCCTTTGTCTTTGGG - Intronic
907620226 1:55970442-55970464 ACCTGTGACCATTTATATAAAGG + Intergenic
908753926 1:67450311-67450333 TTTTGGGACCCTTTAGATTTTGG - Intergenic
911663677 1:100531406-100531428 CCTTGGGAACCTTTATATGTGGG - Intergenic
917213547 1:172655379-172655401 AACAGGGACCCATTATGTTTTGG - Intergenic
923317115 1:232791678-232791700 GCCTTGGTCCCTTTATATTGTGG - Intergenic
1064466929 10:15592727-15592749 ACCTGTGACCCTTGCTACTTGGG - Intronic
1066434518 10:35384758-35384780 CCCTGGGACCCTTTCAGTTTAGG + Intronic
1068889374 10:62132971-62132993 ACCTTGGAACCTGTACATTTAGG + Intergenic
1071628445 10:87197146-87197168 ACCTTAGACCATTTTTATTTGGG + Intergenic
1072267017 10:93740567-93740589 TCCTAGGACCCTTTATCTTCTGG - Intergenic
1077265352 11:1645867-1645889 ACCTGAGTCCCTTGATATTGAGG + Intergenic
1081189799 11:40089463-40089485 ACCTGGGAGCGTTTCTCTTTTGG - Intergenic
1081964902 11:47163587-47163609 TAATGGGACCCTTTAAATTTAGG - Intronic
1082218739 11:49606284-49606306 ACCTATGACCCTTTCTTTTTAGG + Intergenic
1088680649 11:112238911-112238933 GCCTGTAACCCTGTATATTTGGG + Intronic
1101347722 12:103901827-103901849 GCCAGGGACCCTTTCTATCTGGG - Intergenic
1103214332 12:119189871-119189893 TCCTGGGACCCTTTAGTTGTTGG - Intronic
1104111476 12:125709028-125709050 GCCTGGGAGGCTTTATATCTGGG - Intergenic
1105838123 13:24228539-24228561 ACCTGAAACCTTTTTTATTTTGG + Intronic
1108693626 13:52882953-52882975 ACCTTGGACCCTTGTTATTCTGG + Intergenic
1114140215 14:19901249-19901271 ACCTGGGACCCTTTGAACTGCGG - Intergenic
1114540701 14:23455890-23455912 TCAGGGGACCCTTTCTATTTTGG + Intergenic
1116069754 14:40028762-40028784 ATCTGGGTCACTTTATATCTAGG + Intergenic
1116399925 14:44493874-44493896 AGCTGGGACCATTAATTTTTTGG + Intergenic
1118625771 14:67657624-67657646 AGCTGGGTCCCTTTTGATTTTGG - Intronic
1119268881 14:73283761-73283783 ACTTGAGACCCTTGATGTTTGGG + Intronic
1119711655 14:76826832-76826854 ACCTGGGACCCTCTAGAAGTAGG + Intronic
1120471576 14:84932591-84932613 AGCAGGGACCCTTTATTTTAGGG + Intergenic
1129563467 15:76595283-76595305 ATCTGGGTCCGTATATATTTAGG - Intronic
1130079935 15:80724076-80724098 ACCTGTAATCCTTGATATTTGGG + Intronic
1134659076 16:15970196-15970218 GCCTGGGACCCTGATTATTTTGG - Intronic
1138824249 16:60299607-60299629 ACCTGAAACTCTTTATATTCTGG - Intergenic
1146021699 17:29284771-29284793 ACCTGGTTCCCTTTAAACTTGGG + Intronic
1146340627 17:32016645-32016667 ACCTGGGATTCTGTAAATTTGGG + Intronic
1149484032 17:57028012-57028034 ATCTGGGACCCTTAAATTTTGGG - Intergenic
1160456209 18:79003369-79003391 AACCCAGACCCTTTATATTTGGG + Intergenic
1161543574 19:4866959-4866981 ACCTGGGGCCCTTGGAATTTTGG - Intronic
931161425 2:59695720-59695742 ACTTTGAACCCTTGATATTTGGG - Intergenic
935242071 2:101187579-101187601 ACTTGTGACCCCTAATATTTTGG - Intronic
942371596 2:175291704-175291726 CCCTGTGACTATTTATATTTTGG + Intergenic
943169034 2:184372054-184372076 ACCTGAGACACTTAACATTTTGG - Intergenic
944459726 2:199935190-199935212 AAGTGGGACACTTTATATCTGGG - Intronic
946052763 2:216877880-216877902 CCCTGAGATCCTTTCTATTTGGG + Intergenic
1170306634 20:14945532-14945554 ACCTTGCAGCCTTTACATTTGGG + Intronic
1170875896 20:20249769-20249791 CCCTGAGAGCCTTTATCTTTGGG + Intronic
1171092095 20:22294918-22294940 ACCTGTGGCCATTTAAATTTAGG - Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1178169871 21:30028290-30028312 ATCTGGAACATTTTATATTTCGG + Intergenic
1178288619 21:31347118-31347140 ACAGGGGACCCTTTATTTTTAGG - Intronic
1179769097 21:43600113-43600135 CCCTGAGACCTTGTATATTTAGG - Intronic
1182962347 22:34487612-34487634 ACCTTGGAGGCTTTATGTTTTGG + Intergenic
1184517004 22:44968666-44968688 ACCTGGGACCATACATGTTTTGG + Intronic
949419062 3:3845848-3845870 ACCTGGTGCCCTTTATATTCGGG - Exonic
952179597 3:30903688-30903710 ACCTGGGACATTTTATCTTGTGG - Intergenic
955525375 3:59814565-59814587 ATTTGAGACCCTTTATAATTAGG + Intronic
959306918 3:104678656-104678678 CCCTAGAACACTTTATATTTTGG - Intergenic
959469113 3:106727358-106727380 AACTGGCACCCTTAAAATTTAGG - Intergenic
959530943 3:107432964-107432986 ATCTGGGAATCTGTATATTTTGG + Intergenic
960094823 3:113679102-113679124 ACCTGGCTCCATTAATATTTTGG + Intronic
961549948 3:127663806-127663828 ACTTGGGACCCTTGAACTTTTGG + Intronic
962122816 3:132581407-132581429 TCCTGGGATCCATTATCTTTTGG - Intronic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
962481481 3:135801969-135801991 ACCTGGTACCCTTTCACTTTGGG - Intergenic
964217354 3:154301186-154301208 ATCTGTGACATTTTATATTTAGG + Intronic
964456532 3:156874409-156874431 ACCTCTGACCATTTTTATTTGGG + Intronic
965038780 3:163479046-163479068 GCATGGCACCTTTTATATTTAGG - Intergenic
971670524 4:29549611-29549633 ACCTAGGAGCATTTATATTTTGG - Intergenic
974005392 4:56551349-56551371 TTCTGGGACCCTTTTTCTTTGGG + Intronic
975863978 4:78707127-78707149 AACTGGGACCCTTGATACTGAGG + Intergenic
977407000 4:96612430-96612452 ACTTGGGACCCTTTCTTATTTGG - Intergenic
978727536 4:111986960-111986982 ATGTGGTACCCTTTATATTAGGG - Intergenic
978857635 4:113411448-113411470 ACCTTGGACATTTTATATTTGGG + Intergenic
979154647 4:117368885-117368907 ACCTGGAACCTTTTGTATTTAGG - Intergenic
980028238 4:127792228-127792250 ACCTGAGACCCTATATAATCTGG + Intronic
980036910 4:127895394-127895416 ATCTGGGACGTTTTAAATTTTGG + Intronic
980796695 4:137693938-137693960 ACCTGGGTTCCTTTAGAATTAGG - Intergenic
985584335 5:721521-721543 CCCTGGGACCCTCCATATCTCGG - Intronic
986643950 5:9898276-9898298 ATCTGGGCCCCTTTGTATTTGGG - Intergenic
988665032 5:33317103-33317125 ACATAGGACTTTTTATATTTAGG + Intergenic
989990429 5:50757508-50757530 ACCTGGAAACATTTTTATTTGGG + Intronic
1001682736 5:173570710-173570732 CCCTGGGTCCATTTAGATTTGGG + Intergenic
1008306018 6:49901019-49901041 AATTGGGAGCCCTTATATTTAGG - Intergenic
1008699734 6:54084591-54084613 AGCTGGGAACCTTTTTAATTTGG + Intronic
1013782096 6:113740017-113740039 ACCTGGGACCCAGTGCATTTTGG - Intergenic
1015634686 6:135263789-135263811 ACCAGGGAGCCTTTGCATTTTGG + Intergenic
1020840294 7:13209258-13209280 ACATGGGACCCTTCTCATTTTGG + Intergenic
1023231360 7:38033599-38033621 ATCTGGGATCCTTTTTTTTTAGG + Intergenic
1023587762 7:41748962-41748984 AAATGGGACCCTTAATTTTTGGG - Intergenic
1023757990 7:43437870-43437892 TTCTGAGACCCTTTATATATAGG + Intronic
1024529400 7:50378876-50378898 ACCTGGGACCCTTTATATTTAGG - Intronic
1025084021 7:56008189-56008211 ACATGGGACCCTTTATAAGAGGG - Intergenic
1028364178 7:90007607-90007629 AATTGGGACTCTTTAAATTTAGG - Intergenic
1030750219 7:113223676-113223698 ACCTGGGATTCTTTATGCTTTGG + Intergenic
1031283906 7:119841089-119841111 ACCTGGGACCCTTTGTACCACGG - Intergenic
1035862209 8:3041372-3041394 ACCTGGGATTCTTTATGTTTGGG - Intronic
1037181223 8:16007562-16007584 ACATGAGATCCTTTTTATTTGGG + Intergenic
1041441447 8:57901369-57901391 ACCTGCCACACTTTGTATTTGGG + Intergenic
1045428327 8:102088978-102089000 AACTGGGACCCTTAATTTTGGGG + Intronic
1046541650 8:115591437-115591459 ACCTAGGACCTTGTATATTTAGG - Intronic
1055766491 9:79669076-79669098 GCCAGGGAGACTTTATATTTTGG - Intronic
1058147114 9:101424546-101424568 ACCTAGGATACTTTTTATTTTGG - Intronic
1060784719 9:126441938-126441960 AGCAAGGACCTTTTATATTTAGG + Intronic
1190159589 X:48021672-48021694 ACCTGGGCCCCTTTATCCCTGGG - Intronic
1192888655 X:75364224-75364246 AAATGGGACCCTTAATTTTTGGG + Intergenic
1199985016 X:152944283-152944305 CCCTGGGACTCTTTGTATATAGG - Intronic
1201698146 Y:16850593-16850615 ACCTGGGCCCATTTAGATTAAGG + Intergenic