ID: 1024537380

View in Genome Browser
Species Human (GRCh38)
Location 7:50449589-50449611
Sequence ATTCTGTTCTTGATGCAAAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024537376_1024537380 15 Left 1024537376 7:50449551-50449573 CCTACTCAGTACCAAGCACTGTG 0: 1
1: 3
2: 21
3: 195
4: 1240
Right 1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG 0: 1
1: 0
2: 2
3: 29
4: 249
1024537377_1024537380 4 Left 1024537377 7:50449562-50449584 CCAAGCACTGTGCAAGCCTTTCA 0: 1
1: 0
2: 2
3: 28
4: 283
Right 1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG 0: 1
1: 0
2: 2
3: 29
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024537380 Original CRISPR ATTCTGTTCTTGATGCAAAA CGG Exonic
900869931 1:5294944-5294966 AATGTGTTCTTGGTACAAAAAGG - Intergenic
905354608 1:37372654-37372676 ATTCTTTTCTCTAGGCAAAAGGG - Intergenic
905845345 1:41226073-41226095 ATTCTGTACTTTTTGCAAACAGG - Intronic
906385289 1:45363317-45363339 AATCTTTTCAAGATGCAAAAGGG - Intronic
909259595 1:73470097-73470119 ATCCTGTTCTTGCAGCATAATGG + Intergenic
910362549 1:86428618-86428640 ATTCTGTGCTTGGTGCTGAAAGG + Intronic
910661789 1:89681368-89681390 TTAATGTTTTTGATGCAAAAAGG - Intronic
910789615 1:91037579-91037601 GTACTGGTCATGATGCAAAAAGG + Intergenic
911048833 1:93652167-93652189 ATTCTGTTCTGAAAGCAAACAGG + Intronic
911682210 1:100730043-100730065 ATTTTGTTCTTCATTCAATATGG - Intronic
911866523 1:103032014-103032036 ATTCTGCTCTTGATGTAATGTGG + Intronic
912173493 1:107129339-107129361 ATTTTGTGCTTCATGCAGAAAGG - Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919539989 1:198834304-198834326 ACTCTGGTCTAGATGCCAAATGG - Intergenic
921234001 1:213105837-213105859 AGTCTGTTTTTTATGGAAAAAGG + Intronic
1063502305 10:6566396-6566418 ATCCTGGTCTGGATGCGAAAAGG + Intronic
1063667874 10:8075985-8076007 AATCTGTTCATGAAGCAAAGCGG - Intergenic
1064961518 10:20970327-20970349 ATTCTTTTTTTGATCCAAAAAGG - Intronic
1064973506 10:21089715-21089737 ATTCTGTTGTTGAAGCACATTGG - Intronic
1065664617 10:28044557-28044579 ATTATATTATTAATGCAAAAAGG - Intergenic
1067550511 10:47231508-47231530 ATTCTGTTTTAGTTGCTAAATGG + Intergenic
1067683440 10:48454160-48454182 ATTCTGTTCTTCATTCCTAAGGG - Exonic
1068461706 10:57337594-57337616 ATTCAATATTTGATGCAAAAAGG - Intergenic
1069230128 10:65998202-65998224 ATGCTGTTCTTGTATCAAAATGG - Intronic
1071221415 10:83469960-83469982 ACTCTGTTGTTCATGCATAAAGG - Intergenic
1072761138 10:98057854-98057876 ATTCTGTTCATGATGAAATGAGG - Intergenic
1073690697 10:105805795-105805817 ATTCTGTGCTTGAAGTAAGAAGG - Intergenic
1073862370 10:107761909-107761931 ATTCTGTTCTTCACTCAATATGG + Intergenic
1079019531 11:16897708-16897730 TTTGTGTTCCTGAAGCAAAATGG - Intronic
1079710449 11:23677282-23677304 TTTCTATTCTTGATTCACAATGG - Intergenic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1080991060 11:37535496-37535518 ATTCTGTTCTTAATACAAACTGG + Intergenic
1081887523 11:46511668-46511690 ATTCTGTTCGTGATCTAAAAAGG - Intronic
1082620671 11:55417768-55417790 ATACTGATCTAGATGCAAAAAGG - Intergenic
1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG + Intronic
1084308255 11:68300455-68300477 CTTCAGTACTTGAAGCAAAATGG - Intergenic
1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG + Intergenic
1085718378 11:78892521-78892543 CTTATGTTCTTCATGTAAAAAGG + Intronic
1085866560 11:80301666-80301688 ATTCTCTCTTTGAAGCAAAAAGG + Intergenic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1091080288 11:132660706-132660728 AATCTGTTCCTGATGCAATCAGG + Intronic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1092909509 12:13134247-13134269 AATCTCTCCTTTATGCAAAAAGG - Intronic
1093209392 12:16289547-16289569 ATTCTGTTCTTTCTGCACAATGG - Intergenic
1093280994 12:17196055-17196077 ATTCTGTTATAGAAGCACAAAGG + Intergenic
1093559280 12:20518672-20518694 ATTCTCTTTTACATGCAAAAGGG - Intronic
1095634170 12:44412657-44412679 ATTCTGTTGTAGAAGCAAAGTGG - Intergenic
1096443182 12:51663664-51663686 ATTCTGTTATTCATGCAAGTAGG + Intronic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1098368306 12:69730380-69730402 ATTGTGTTTGTGAGGCAAAATGG - Intergenic
1098490551 12:71071306-71071328 ATTGTGTTTCTGATTCAAAATGG - Intronic
1099335327 12:81348902-81348924 ATTTTGTTCTTGATTACAAATGG + Intronic
1100197290 12:92261350-92261372 ATTCTGTTATTGTTGTTAAATGG + Intergenic
1101239761 12:102826054-102826076 AATCTGTTCTCGCTGCTAAAAGG + Intergenic
1102555013 12:113721015-113721037 ATTCTGTCCTTGCTGGAAATGGG - Intergenic
1105383000 13:19904841-19904863 ATTCTGTACATGATACAACATGG - Intergenic
1105402543 13:20108809-20108831 ACTTTTTTCTTGCTGCAAAAAGG + Intergenic
1105755885 13:23463950-23463972 ATTCTGATCTTGGACCAAAAAGG + Intergenic
1106399497 13:29415336-29415358 TTTCTACTCTTGATTCAAAATGG - Intronic
1106595543 13:31132378-31132400 ATTTTGGGATTGATGCAAAATGG - Intergenic
1106860567 13:33903055-33903077 ATTTTATTCTTGGTGGAAAAGGG - Intronic
1107798406 13:44079250-44079272 ATTCTGGTCTTGTTGGAAATGGG - Intergenic
1108271219 13:48761331-48761353 ATTCTTATTTTCATGCAAAAAGG - Intergenic
1108461884 13:50675144-50675166 ATTCTTCCCTTGAGGCAAAAGGG - Intronic
1110048832 13:70868081-70868103 AATCTGTTCTTTTTTCAAAATGG - Intergenic
1111490406 13:88965775-88965797 ATTCTTTTATTGATGGAAACAGG + Intergenic
1112380432 13:98883737-98883759 ATTTTTTTCTTCTTGCAAAATGG + Intronic
1113229652 13:108198397-108198419 ATTTTGTACATGATGCAAGAAGG + Intergenic
1114905934 14:27126523-27126545 ATTCTGTTCTTTCTCAAAAATGG + Intergenic
1115098690 14:29671801-29671823 GTTCTGTTCTTCTTACAAAAGGG - Intronic
1116637063 14:47410195-47410217 ATGCTTTTCTTGGTGCTAAATGG - Intronic
1117091484 14:52255184-52255206 TTTGTGTTCTAGAAGCAAAAAGG - Intergenic
1118573687 14:67219909-67219931 ATTATGTTCCTGATGCAAATAGG - Intronic
1119078218 14:71666048-71666070 ATTCTGTAGTTGTTGAAAAATGG - Intronic
1119079876 14:71682820-71682842 ATTATCTGCCTGATGCAAAATGG + Intronic
1119449639 14:74698100-74698122 ATTCTGAACTTGAAGCAGAAAGG + Intronic
1121807858 14:96847682-96847704 CCTCTGTTCTTCATGCAAAAGGG + Intronic
1127131728 15:55872414-55872436 ATTTTGTTCTTCATCCAAGAAGG - Exonic
1127355128 15:58190907-58190929 ATTTTAATTTTGATGCAAAAAGG + Intronic
1129309218 15:74694161-74694183 ATTCTGTAATTAATACAAAATGG - Intronic
1130075123 15:80682046-80682068 ATTCTGTTCTTTATTCCACATGG - Intronic
1131584846 15:93682274-93682296 ATGCTGGTCTTGATGTGAAAAGG + Intergenic
1136473668 16:30498542-30498564 TTTCTCTTCTTCATGGAAAATGG + Intronic
1138938845 16:61764481-61764503 ATTCAATTCCTGATGCAACATGG + Intronic
1140190418 16:72811185-72811207 ACTCTGTTTTTGTTGTAAAAGGG - Intronic
1140529699 16:75654114-75654136 CATCTGTTCTTGATTCAGAAGGG - Intronic
1140685795 16:77433396-77433418 ATTCGGTTCTTGATGGAAGAAGG + Intronic
1142798435 17:2327942-2327964 ATTCTTTTATTGTTTCAAAATGG - Intronic
1147418561 17:40310595-40310617 GTTCTGGTCTTGATCCAACAAGG + Intronic
1147484891 17:40803220-40803242 TTTCTTTTCTTGTTGTAAAATGG - Intergenic
1148975435 17:51523790-51523812 ATTCTGTTGTTCATGCATAGTGG + Intergenic
1149256671 17:54835448-54835470 ACTCTGTTCTTGTAGCACAAAGG - Intergenic
1149604591 17:57915919-57915941 ATTCTGTGTTTGATTCAAACGGG - Intronic
1151168806 17:72228216-72228238 ATTCTGGCCTTTATGCATAATGG + Intergenic
1153275295 18:3361577-3361599 ATTCTGTTGTTGATGGACAGTGG + Intergenic
1154985124 18:21543503-21543525 ATCCTTTTTTTGATGGAAAAAGG - Intronic
1155154018 18:23143591-23143613 ATTCTGTCCTTGTAGCACAAAGG - Intronic
1155867284 18:30981612-30981634 ATTTTGTTGTTGTTGCAAATTGG - Intergenic
1156536709 18:37871375-37871397 CTTCTGTTCTTGATGCAACTGGG - Intergenic
1159163427 18:64673294-64673316 ATTCTGTCCTTCGTGCAACATGG + Intergenic
1160340094 18:78082385-78082407 TTTCTGTACTTGCTGCAAAAGGG + Intergenic
1163259031 19:16175689-16175711 TTGCTGGTGTTGATGCAAAATGG + Intergenic
1163880117 19:19912260-19912282 ATTCTGTTCTCTATGCAACTAGG - Intronic
1164240027 19:23378393-23378415 ATTCTGTTCTTTATGCCACTGGG + Intronic
1165440576 19:35824729-35824751 AGTCTGTTCTTCATGGAAACAGG + Intergenic
1165470764 19:36003218-36003240 ATTCTGTTCTCAAGGCAAAAGGG + Intergenic
1166779171 19:45331451-45331473 ATTCTGTTGCTTATGCAAACTGG - Intergenic
1167780916 19:51598321-51598343 CTTCTCTTCTTGGTGCATAATGG + Intergenic
1167783506 19:51616411-51616433 ATTGTGTACTTGATGCAAAAAGG + Intronic
1168654195 19:58115288-58115310 ATTCTATTCTGGATTCAACAGGG + Intronic
925872958 2:8286426-8286448 ACTCATTTCTTCATGCAAAATGG + Intergenic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
929139727 2:38656301-38656323 ATTCTGTTAATGTAGCAAAAAGG - Intergenic
929782068 2:44963501-44963523 ATTGTCTTCTTGATTCAAATAGG + Intergenic
930269254 2:49236578-49236600 ATTCTCTTCCTGAAGCAACAAGG + Intergenic
931483151 2:62663362-62663384 AAACTGTTCTTGATGCAAAAAGG + Intergenic
935524208 2:104145714-104145736 ATTCTGATCTTCATACAAACAGG - Intergenic
936501706 2:113072084-113072106 ATTCTGTTCCAGATGGAAAATGG - Intronic
936767356 2:115869163-115869185 ATTCTCTTTTTGATGCTTAAGGG + Intergenic
937036669 2:118787814-118787836 ACTCTGGTCTTGAAGGAAAAAGG + Intergenic
939183979 2:138839044-138839066 ATTCTGTACTTGCTGCAAAGAGG - Intergenic
942966274 2:181896196-181896218 ATTCTGAGCTAGAAGCAAAATGG + Intronic
945486527 2:210403126-210403148 CGTCTGTTATTGATGCATAAGGG + Intergenic
947280282 2:228444843-228444865 ATTCTGTTCTTGGAGTCAAAAGG + Intergenic
947363977 2:229375103-229375125 ATTCTGTACTTGCAGCAAATTGG + Intronic
1170137864 20:13094930-13094952 ATTGAGTGTTTGATGCAAAATGG - Intronic
1170594449 20:17794556-17794578 ATTGTTTTCTTCATGAAAAAAGG + Intergenic
1170734289 20:19000636-19000658 ATTCTTTTCCAGATGGAAAATGG + Intergenic
1173051153 20:39563213-39563235 ATTAAGTTCTTTAAGCAAAATGG + Intergenic
1173873224 20:46354554-46354576 ATTTTGTTCTACCTGCAAAATGG + Intronic
1174714334 20:52741057-52741079 ATTCTTTTATTCTTGCAAAATGG + Intergenic
1175211131 20:57356565-57356587 ATTCTGTACTTTAAGTAAAATGG - Intronic
1175352862 20:58337930-58337952 ATTTTGTTTTTGATGTGAAATGG + Intronic
1177633368 21:23754925-23754947 ATTTAGTTCTTGCTGTAAAATGG + Intergenic
1178073439 21:28993762-28993784 ATTCTGTGATTGTTGGAAAAAGG - Intergenic
1181271694 22:21662478-21662500 ATTCATTGCTGGATGCAAAATGG - Intronic
949259631 3:2090425-2090447 ATTCTGTATTTGAAGCAACATGG + Intergenic
949862185 3:8515870-8515892 GTTCTGATCTTGGTGCAGAATGG - Intronic
950031798 3:9858652-9858674 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950417125 3:12875152-12875174 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
951143907 3:19202760-19202782 ACTCTGTTATTGAAGCCAAAAGG - Intronic
951820716 3:26808048-26808070 ATTCTCTTCTTGATAAAAACAGG - Intergenic
952057439 3:29464873-29464895 ATTCTGTTATTGATACAGAGTGG - Intronic
955696286 3:61640667-61640689 ACCCTTTTCATGATGCAAAATGG + Intronic
955730373 3:61979172-61979194 ATTCAGATTTTGATGCAATATGG + Intronic
955830722 3:63000355-63000377 ATTCTGGTTTTGATGTAACAGGG + Intergenic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
956316320 3:67941714-67941736 TTTCTGTACTAGATGCTAAAAGG + Intergenic
958542134 3:95491785-95491807 AATCCATTCTTTATGCAAAAAGG + Intergenic
959430204 3:106245047-106245069 ATTTTGTTCTTGATTCATATAGG + Intergenic
960373425 3:116868971-116868993 AGTCTGTTCTTGATGATACATGG + Intronic
961783848 3:129337655-129337677 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
963324433 3:143846413-143846435 ATTCTGTTCATGATGGAGATAGG + Intronic
964036861 3:152209512-152209534 ATTCAGCTCTTGCTGCAAAGTGG + Intergenic
964201839 3:154126226-154126248 ATTCTGTAGTTGATGAGAAAAGG + Intronic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
964829957 3:160873383-160873405 ATTTTGTTCTGAATTCAAAACGG + Intronic
965422189 3:168474810-168474832 ACTTTCTTCTTGATGGAAAAGGG + Intergenic
965845535 3:172956844-172956866 ATATTGTTATTGATGCCAAATGG - Intronic
966373519 3:179272810-179272832 ATTTTGTACTTCATGTAAAATGG - Intergenic
970437484 4:16049322-16049344 GTTCTGTTCTACATGGAAAAAGG + Intronic
971459346 4:26878082-26878104 ATTCTGTTATGGCTGCACAAAGG + Intronic
971797031 4:31241639-31241661 ATTCTTTATTTGATGGAAAAAGG + Intergenic
972214469 4:36879753-36879775 ATAATTTTCTTGTTGCAAAATGG + Intergenic
974426892 4:61753284-61753306 ATTCTGTTTTTGATTCCAGAAGG + Intronic
974529850 4:63093599-63093621 ATTCTGGTCTAGATGGAATATGG + Intergenic
975713022 4:77179218-77179240 ATTCTGTTCTTTATGAAATGAGG + Intronic
976369825 4:84274515-84274537 AGTCTGTTCTCCATACAAAAAGG + Intergenic
976860089 4:89654755-89654777 ATTGTGTTCCTGAGGCAAACTGG + Intergenic
977809559 4:101345216-101345238 ATTTTGTTCTTTCTGAAAAAAGG + Intronic
981366759 4:143912815-143912837 ATGCTGTTCTTGTTGCAAACTGG + Intergenic
981376556 4:144023047-144023069 ATGCTGTTCTTGTTGCAAACTGG + Intergenic
981387065 4:144144392-144144414 ATGCTGTTCTTGTTGCAAACTGG + Intergenic
982077519 4:151752628-151752650 ATTGTGTTCTTGTTTCAAAGAGG + Intronic
982092618 4:151893523-151893545 ATTCAGTTCTACAGGCAAAAAGG - Intergenic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
983304791 4:165972381-165972403 ATTCTTTTCATGATGCTACATGG + Intronic
986239552 5:5946613-5946635 GTTCTGTTCTTGATCTTAAAGGG + Intergenic
986582619 5:9281216-9281238 ATTCTGTGCTAGAGGGAAAATGG - Intronic
986795907 5:11211717-11211739 ATTCTTTTGTTCATGCAAAATGG + Intronic
987435719 5:17891655-17891677 ATTATGCTTTTGATGAAAAATGG - Intergenic
988448808 5:31318849-31318871 ATTCTGTTCTTGGTGAAATGCGG - Intronic
988615610 5:32771754-32771776 ATTCTGTTCTTATTGTACAAGGG - Intronic
988837422 5:35046976-35046998 TTTCTGTTCTTGCTGCAGAGAGG + Intronic
989631743 5:43490911-43490933 ATTTTATTCTTGATGAATAATGG - Intronic
990147030 5:52773672-52773694 ATTTTGTTATATATGCAAAAAGG - Intergenic
990799866 5:59588309-59588331 ATTTTATTCTTGCTCCAAAATGG - Intronic
992214564 5:74513609-74513631 ATTATCTTCTTCATGTAAAATGG - Intergenic
993485088 5:88474160-88474182 ATTATGTTCTTGGAGGAAAAGGG + Intergenic
993915026 5:93733850-93733872 ATTCTTTTCAGAATGCAAAATGG - Intronic
996696648 5:126404383-126404405 ATCATGTCCTTGATGCAAACTGG - Intronic
1002840954 6:906880-906902 TTTTTCTTCTTGATACAAAAAGG - Intergenic
1004214000 6:13684499-13684521 ATTGTATGATTGATGCAAAATGG - Intronic
1007361112 6:41356572-41356594 ACACTGTTCTTGATGAAGAAGGG + Intergenic
1008320630 6:50108496-50108518 AATCTGTCCTTGAAGCATAAAGG + Intergenic
1009943343 6:70315492-70315514 ATTCTGTTCTATAGGCAGAAGGG + Intergenic
1010079799 6:71847498-71847520 ATTCTGTCCTTAATACAAAAAGG - Intergenic
1010089921 6:71968729-71968751 ATCATGTTATTGATGCTAAAAGG + Intronic
1010406479 6:75511743-75511765 AATCTCTTTTTGATCCAAAATGG + Intergenic
1010706140 6:79113176-79113198 CTTATGTTCTGGAAGCAAAAAGG - Intergenic
1010741688 6:79513623-79513645 ATACTGATCTTGTTACAAAACGG - Exonic
1012168989 6:95994843-95994865 ATTCTGTCCTTCATGAAAAATGG - Intergenic
1012976288 6:105784254-105784276 ATTCTGGTATTGCTCCAAAAGGG + Intergenic
1013126976 6:107193265-107193287 ATTCTGATCTTGGTGAAAGAGGG + Intronic
1016632978 6:146253419-146253441 ATTTTATTGTTGATGAAAAATGG + Intronic
1017246163 6:152227903-152227925 ATTCTGTTTCTGATCAAAAAGGG + Intronic
1018695350 6:166386718-166386740 ATTCTGTTCTTGACAAAAATTGG - Intergenic
1020456796 7:8382730-8382752 ATTGTGATCTAGATCCAAAAAGG - Intergenic
1020825973 7:13028887-13028909 TTTTTGTTATTGATACAAAAGGG + Intergenic
1021607681 7:22425591-22425613 AGTCTGTACTTTAAGCAAAATGG - Intronic
1022185320 7:27961667-27961689 ATTCTATTCTTTATCCAAAAAGG - Intronic
1022194884 7:28055233-28055255 AATGTGTTAGTGATGCAAAAAGG - Intronic
1023104871 7:36754017-36754039 TTTCTGTTTTTGATGAAAATTGG - Intergenic
1023531459 7:41160399-41160421 CTTATGTTCTTGCTGGAAAAGGG - Intergenic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1027452290 7:78345992-78346014 ATCCTGTCCTGGAAGCAAAAAGG - Exonic
1029012781 7:97279829-97279851 TTTCTTTACTTGATGTAAAAAGG - Intergenic
1029412766 7:100426551-100426573 ATACTGTTATTAATGCAAAAAGG - Intronic
1030336419 7:108332308-108332330 AAAATGTTCTTGATGCAAATTGG + Intronic
1031270536 7:119643876-119643898 ATGCTGTTCTTGATACTCAATGG + Intergenic
1031829391 7:126608180-126608202 ATTCTGAACTTGATGGATAAGGG - Intronic
1031841715 7:126749881-126749903 TTGCTGTTAGTGATGCAAAATGG + Intronic
1032524715 7:132571306-132571328 ATTATTTTCTTCATGCAAATGGG + Intronic
1033073366 7:138225182-138225204 GTTTTCTTCTTGAGGCAAAATGG - Intergenic
1034926899 7:155129905-155129927 ATTCAGTTCTTCATGGGAAAGGG + Intergenic
1036292790 8:7509191-7509213 TTTCTGTTTTTGCAGCAAAATGG - Exonic
1036329772 8:7811818-7811840 TTTCTGTTTTTGCAGCAAAATGG + Exonic
1036703527 8:11029891-11029913 CTTCTGTTATGGATGGAAAATGG - Intronic
1037730268 8:21518023-21518045 ATTCTGCTCTTGATTCAGAAGGG - Intergenic
1038056779 8:23866125-23866147 ATTCTCTTCTGGATGCCAGAAGG - Intergenic
1039723993 8:40195690-40195712 ATTCTGATCTTGGTGTAAAAAGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040851701 8:51907557-51907579 ATTCTGTTCTTCTTGGAAAATGG - Intergenic
1042309142 8:67363165-67363187 ATGCTATTATTTATGCAAAATGG + Intergenic
1044106294 8:88211231-88211253 ATTTTGTTCTTCCAGCAAAATGG - Intronic
1048131381 8:131701532-131701554 TTTTTGTTCTTGATCCAAAATGG - Intergenic
1048546664 8:135393866-135393888 AGTCTGTACTTGATGCTCAAAGG - Intergenic
1050306871 9:4313631-4313653 ACTCTGTTCTTGAGTCAAAATGG + Intronic
1050342758 9:4657056-4657078 ATTTTCTTCTTGAAACAAAAGGG + Intronic
1050775308 9:9252289-9252311 CTTCTCTTCCTGATACAAAAAGG - Intronic
1051187163 9:14472374-14472396 TTTCTGTTCTTGTTCCAAAGTGG - Intergenic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1051831624 9:21285400-21285422 ATTGTGTTCCTGATTTAAAAGGG - Intergenic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1053569989 9:39294699-39294721 ATTCTGTTTATTATGAAAAATGG - Intergenic
1054091618 9:60853702-60853724 ATTCTGTTTATTATGAAAAATGG - Intergenic
1054113033 9:61129276-61129298 ATTCTGTTTATTATGAAAAATGG - Intergenic
1054127160 9:61324311-61324333 ATTCTGTTTATTATGAAAAATGG + Intergenic
1054594683 9:67052916-67052938 ATTCTGTTTATTATGAAAAATGG + Intergenic
1054838805 9:69712483-69712505 ATTATGTATTTTATGCAAAATGG + Intronic
1054944251 9:70778161-70778183 ATCCAGTTTTTGATGGAAAAGGG + Intronic
1055604876 9:77958317-77958339 ATTCTGTTCGTGTTGCCAATAGG - Intronic
1055789602 9:79909644-79909666 ATACAGTTTTTGATGCAAAGAGG + Intergenic
1056748855 9:89330039-89330061 ATTATGATGTTGATGAAAAAAGG + Intronic
1056788503 9:89610322-89610344 AGGGTGTTTTTGATGCAAAAAGG - Intergenic
1057251252 9:93504684-93504706 ATTCTACTGTTGATGGAAAATGG + Intronic
1057465250 9:95308179-95308201 AGTATGTTTTTGAGGCAAAATGG - Intronic
1059049424 9:110906921-110906943 AATCCTTTATTGATGCAAAAGGG + Intronic
1059080273 9:111241910-111241932 ATTTAGTTCTTGATACCAAATGG + Intergenic
1060030036 9:120206523-120206545 ATTCTGTTCTTGGTCCAAGCTGG + Intergenic
1060380263 9:123163474-123163496 ATTCTGATGGTGATGGAAAAGGG - Intronic
1060541874 9:124436471-124436493 GTTCTATTCTTGTGGCAAAAGGG - Intergenic
1060911277 9:127352997-127353019 ATTCAGTTCTGTAAGCAAAAGGG - Intronic
1186262473 X:7794030-7794052 CCTCTCTTCTTGATGCAAAGAGG + Intergenic
1186706257 X:12142086-12142108 CTTCTTTTCTTTAAGCAAAACGG + Intronic
1188368725 X:29342454-29342476 ATTCTGTTTTTACTGCTAAATGG - Intronic
1192674266 X:73178341-73178363 TTTATTTTCTTGATGTAAAATGG - Intergenic
1193437211 X:81489957-81489979 ATAGTGTTATTGATACAAAAAGG - Intergenic
1193481145 X:82030791-82030813 ATTCTGTTGTTGCAGCAACATGG + Intergenic
1193558580 X:82987734-82987756 ATTGTGTTTTTGATGCTAAAGGG - Intergenic
1193680152 X:84508970-84508992 TTTCTGTTTTTAATGCAGAATGG - Intergenic
1195217831 X:102717834-102717856 ATTCTGTTCTTGAGTTAAGAAGG + Intergenic
1195239848 X:102940141-102940163 ATTATGTTTTTATTGCAAAATGG + Intergenic
1196045962 X:111256719-111256741 ATTCTCTTCTTGACCCAAGATGG + Intronic
1196462440 X:115944494-115944516 ACTTTGTGCTTGTTGCAAAAAGG + Intergenic
1197993588 X:132346984-132347006 ATTGTGTTCTTGATTCAATTTGG - Intergenic
1199838412 X:151617702-151617724 TTTCTGTTCCTGATGCAAACTGG + Intronic
1199891302 X:152085185-152085207 AATCTGTTCTTGATGGATATGGG - Intergenic
1200972409 Y:9167246-9167268 ACTCTGTTCTTGCTGTTAAAGGG + Intergenic
1202138612 Y:21697005-21697027 ACTCTGTTCTTGCTGCTAAAGGG - Intergenic