ID: 1024537579

View in Genome Browser
Species Human (GRCh38)
Location 7:50450659-50450681
Sequence GAGCCACGCTTTGCTCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024537579_1024537581 -6 Left 1024537579 7:50450659-50450681 CCTGGGAGAGCAAAGCGTGGCTC 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1024537581 7:50450676-50450698 TGGCTCTCCTGCGCCCACCCGGG No data
1024537579_1024537588 27 Left 1024537579 7:50450659-50450681 CCTGGGAGAGCAAAGCGTGGCTC 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1024537588 7:50450709-50450731 ATGGCTCACCTGCGCCCACCCGG 0: 1
1: 0
2: 3
3: 18
4: 171
1024537579_1024537589 28 Left 1024537579 7:50450659-50450681 CCTGGGAGAGCAAAGCGTGGCTC 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1024537589 7:50450710-50450732 TGGCTCACCTGCGCCCACCCGGG 0: 1
1: 2
2: 2
3: 29
4: 278
1024537579_1024537580 -7 Left 1024537579 7:50450659-50450681 CCTGGGAGAGCAAAGCGTGGCTC 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1024537580 7:50450675-50450697 GTGGCTCTCCTGCGCCCACCCGG No data
1024537579_1024537585 8 Left 1024537579 7:50450659-50450681 CCTGGGAGAGCAAAGCGTGGCTC 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1024537585 7:50450690-50450712 CCACCCGGGAGAGCAAACAATGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024537579 Original CRISPR GAGCCACGCTTTGCTCTCCC AGG (reversed) Intronic
900097245 1:944947-944969 GGGCCAGGCTTTTCCCTCCCTGG - Intronic
900690220 1:3976369-3976391 GTCCCTCGCTTTCCTCTCCCTGG - Intergenic
901065373 1:6491669-6491691 GGTCCACCCTTTCCTCTCCCTGG + Intronic
903071924 1:20730969-20730991 GAGCCACCCTTTGCTGACCCAGG - Intronic
903361491 1:22780042-22780064 TAGCCACGGTTTTCTCTCTCAGG + Intronic
904819847 1:33234846-33234868 AAACCACTCTTTGATCTCCCTGG - Intergenic
909183285 1:72450972-72450994 GAGCTAACCTTTGGTCTCCCAGG - Intergenic
911241926 1:95476952-95476974 GACCCATGCTTTTCTCTCCTTGG + Intergenic
915321476 1:155058682-155058704 GATCCAGGCTCTTCTCTCCCTGG + Intronic
917415036 1:174800237-174800259 GAGCCAGGTTTAGGTCTCCCTGG - Intronic
919785262 1:201254620-201254642 AACCCCTGCTTTGCTCTCCCTGG - Intergenic
920215661 1:204360092-204360114 GAGCCACCCCATCCTCTCCCGGG - Intronic
921122892 1:212151920-212151942 GAGCCTCGCTCTTATCTCCCAGG - Intergenic
1064321789 10:14311670-14311692 CAGCCACGTCTTGCTCTCCAGGG + Intronic
1067339217 10:45387640-45387662 GAGCCAGGCTTGGTTCTCACTGG - Intronic
1070813345 10:79309363-79309385 GAGCCCCTCCCTGCTCTCCCAGG + Intronic
1073009095 10:100346549-100346571 CAGCCACGCGCTGCTCACCCGGG - Intergenic
1073606936 10:104905819-104905841 GAGACACTCTCTTCTCTCCCGGG + Intronic
1076106772 10:127829651-127829673 GAGCCAGGCTTGGCTCTCCCAGG - Intergenic
1076563387 10:131381850-131381872 GAGTCACACTTCCCTCTCCCTGG + Intergenic
1077209694 11:1363595-1363617 TTGCCACGCCTTTCTCTCCCAGG + Intergenic
1078602564 11:12746802-12746824 GAGCCAGGCTGCGTTCTCCCAGG + Intronic
1080521542 11:33071785-33071807 GAGACATGCTCTGCTCTCCGAGG - Intronic
1081380818 11:42412552-42412574 CAGGCATGCTGTGCTCTCCCAGG + Intergenic
1081594084 11:44447171-44447193 GGGCCACGCTGGGCTCTCCAGGG + Intergenic
1081876836 11:46414339-46414361 GAGGCATGCTTTCCCCTCCCTGG + Intronic
1083278077 11:61608798-61608820 GAGCCCAGCTCTGCTCTCCCAGG + Intergenic
1084484831 11:69442156-69442178 GAGCCAGACTCTGGTCTCCCAGG - Intergenic
1084747622 11:71183338-71183360 GAGCCCCTCTCTGCTCACCCGGG - Intronic
1084770890 11:71342230-71342252 GAGTCACCCTTGACTCTCCCGGG - Intergenic
1085542785 11:77288202-77288224 GGGCCAATCTTTGGTCTCCCAGG - Intronic
1088626500 11:111733878-111733900 GAGCCGGGCCTTGCTCTCCCAGG - Intronic
1099105567 12:78491779-78491801 GACCCAAGCTTCCCTCTCCCAGG - Intergenic
1099815332 12:87639305-87639327 GAGCAACACTTTTCTGTCCCTGG - Intergenic
1101643009 12:106601956-106601978 CAGCCAGGCTTTCCTCTCCATGG + Intronic
1103894105 12:124261917-124261939 GAGCCATGCATTTCTCTCCTGGG + Intronic
1104031376 12:125067557-125067579 AAGCCTCGCTTTTCTCCCCCAGG + Intronic
1104064398 12:125295226-125295248 CAGCCACGGAGTGCTCTCCCAGG - Intronic
1108385664 13:49897070-49897092 GAGCCACCCATTTCTCCCCCAGG - Intergenic
1110752199 13:79127822-79127844 AAGCCACTGTTTGCTCTTCCTGG - Intergenic
1113654115 13:112057447-112057469 GCGCCAGGCTGCGCTCTCCCCGG + Intergenic
1113941659 13:114021572-114021594 AGGCCACGCTTTGTTCCCCCAGG + Intronic
1115914048 14:38289997-38290019 CAGCCAGGCTTTTGTCTCCCAGG - Intergenic
1120202423 14:81552508-81552530 GAGTCTCGCTTTTGTCTCCCAGG - Intergenic
1121521259 14:94587584-94587606 GAGCCTGGCCATGCTCTCCCTGG + Exonic
1122791008 14:104184168-104184190 GAGCCACGGTCTGATTTCCCGGG + Intergenic
1125458116 15:39881136-39881158 GTACCATGCTTTGCTCTCACTGG + Intronic
1125954049 15:43777079-43777101 GGGCGGCGCTTCGCTCTCCCCGG + Exonic
1126143537 15:45456324-45456346 GGGCCAGGCTCTGCTCTCACTGG - Intergenic
1127290199 15:57563033-57563055 GAACCACGCCTTTCTCTCTCGGG + Intergenic
1127372634 15:58355381-58355403 GCCCCCAGCTTTGCTCTCCCCGG + Intronic
1127958154 15:63870930-63870952 GAGCCAAGCTTTGTCCTCCCTGG - Intergenic
1128360987 15:66961670-66961692 CAGCCAAGCTTGGCTCTGCCTGG + Intergenic
1129191694 15:73941352-73941374 GACCCTAGCTTTGCTCTCCCTGG - Intronic
1129244929 15:74273492-74273514 GAGCCTCGCTCTTGTCTCCCAGG + Intronic
1130341296 15:83001244-83001266 GAGCCAGGCTGTTCTTTCCCAGG + Intronic
1137898137 16:52236353-52236375 AAGTCGAGCTTTGCTCTCCCAGG - Intergenic
1140864315 16:79046648-79046670 GAGCCAAGCTATGCTCACCGTGG - Intronic
1141848946 16:86630852-86630874 AAGCTACGCTTCCCTCTCCCAGG + Intergenic
1142064270 16:88051573-88051595 GAGCCACGGTTCCCTCTCTCAGG + Intronic
1143095485 17:4476426-4476448 GCTCCCCGTTTTGCTCTCCCCGG - Intronic
1147949449 17:44098833-44098855 CACCAACGCTTGGCTCTCCCTGG - Intronic
1149322536 17:55496189-55496211 GCGGCACACTTTTCTCTCCCTGG + Intergenic
1150809719 17:68346960-68346982 AAGCCAGGCTTTGCTCTCTGGGG - Intronic
1152376814 17:79922812-79922834 GTTCCAGCCTTTGCTCTCCCAGG + Intergenic
1152741518 17:82020475-82020497 CAGCCCCGCTCTGCGCTCCCAGG - Intronic
1157566785 18:48683804-48683826 GAGCCACCATTTACCCTCCCTGG - Intronic
1160395106 18:78564875-78564897 GAGCCACGCTGCCCTCACCCCGG + Intergenic
1160748176 19:721032-721054 GGGCCACGCTGTGCCCTCCCTGG + Intronic
1164596960 19:29536579-29536601 GTGCCACGCTCTCCTCTCACCGG + Intronic
1165136817 19:33674766-33674788 GAGCCTCACTTTCCTCTGCCAGG + Intronic
1165936155 19:39390235-39390257 GAGCCCCACTGTGCTTTCCCAGG - Intronic
1166639754 19:44485748-44485770 GAGCCACACTCAGCTTTCCCTGG + Intronic
1166745254 19:45138937-45138959 GAGTCTCGCTTTTGTCTCCCAGG + Intronic
1167323103 19:48808159-48808181 GACCCACGCTCTGATCACCCCGG - Intronic
1168692257 19:58384321-58384343 GGGCCAGGCTTGGCTCTGCCAGG + Intergenic
925815526 2:7744347-7744369 TAGCCAAGCTCTGCTGTCCCAGG + Intergenic
927023179 2:19038966-19038988 GAGACATGCTTTTCTCTCTCTGG - Intergenic
928101480 2:28439981-28440003 GAGCCCCGCTTTACTTTCACAGG + Intergenic
931322805 2:61188260-61188282 TGGCCAAGCTTTGCCCTCCCAGG - Exonic
933082340 2:78006555-78006577 TAGCCACTCTTTGAACTCCCAGG + Intergenic
937125589 2:119473355-119473377 GTGCCACCCTGTCCTCTCCCAGG + Intronic
938271974 2:129980169-129980191 TTGCAACGCTTTGCTCCCCCAGG - Exonic
938444034 2:131363645-131363667 TTGCAACGCTTTGCTCCCCCAGG + Intergenic
943609818 2:190019190-190019212 GAGCCACTGTTTGAACTCCCAGG + Intronic
944786777 2:203079293-203079315 GAGCCACGAATTGCTCAACCTGG - Intronic
947154145 2:227144704-227144726 GATCCATGCTTTCCTCTCTCTGG + Intronic
948145159 2:235703229-235703251 GAGCCACGGTTTTCCATCCCTGG + Intronic
948569793 2:238910739-238910761 GAGGCCCCCTCTGCTCTCCCAGG - Intergenic
1170296366 20:14831074-14831096 GAGCCTCACTTTGCTCACCTGGG + Intronic
1172354394 20:34269402-34269424 GAGTCCCGCGCTGCTCTCCCGGG + Intergenic
1173933381 20:46840264-46840286 CAGCCACGGTTTCCTGTCCCAGG + Intergenic
1178953794 21:37006295-37006317 GGGCCTCGCTTTCCTCTCCCGGG + Intronic
1179063794 21:38005106-38005128 TAGCCACTGTTTGCTTTCCCTGG - Intronic
1179492859 21:41752573-41752595 GAGCCACACTCTGCACTCCAGGG + Intronic
1179564239 21:42236430-42236452 GTGCCACGCTTTGCTGTCTCTGG + Intronic
1180869836 22:19139875-19139897 ACGCCACGCTTGGCTCTACCAGG - Exonic
1180957810 22:19748861-19748883 AAGGGTCGCTTTGCTCTCCCTGG + Intergenic
1181452515 22:23033465-23033487 CTGCCTCTCTTTGCTCTCCCTGG + Intergenic
1181994145 22:26861551-26861573 GAGTCTCGCTCTTCTCTCCCAGG - Intergenic
1182022170 22:27090473-27090495 GGGCCATGCCTTGCTCTTCCTGG - Intergenic
1182376052 22:29848899-29848921 GAACCACCCTTTCATCTCCCTGG - Intergenic
1182434123 22:30319472-30319494 AAGCCTTGGTTTGCTCTCCCAGG + Intronic
1182677064 22:32047589-32047611 GACCCAAGCCATGCTCTCCCGGG + Intronic
1183730213 22:39614362-39614384 GACCTACCCTCTGCTCTCCCCGG - Intronic
1184517464 22:44971523-44971545 TGTCCACCCTTTGCTCTCCCGGG + Intronic
950365987 3:12484526-12484548 GGGCCGCGCTTTCCTCGCCCAGG - Exonic
954468760 3:50674505-50674527 GAGCCACCCTGTGCATTCCCAGG - Intergenic
960110515 3:113840303-113840325 GAGGCCTGCCTTGCTCTCCCTGG - Intronic
961447247 3:126986639-126986661 GAGCCAGGCCCTGCTCTCACAGG + Intergenic
961654723 3:128435034-128435056 GAGCCACGCAGTGAGCTCCCAGG - Intergenic
966495356 3:180573995-180574017 GGGCCACAACTTGCTCTCCCTGG + Intergenic
968280857 3:197475708-197475730 GACCCAAGCTTTTCTCTGCCTGG + Intergenic
968649349 4:1754253-1754275 GAGCCTGGCTGGGCTCTCCCGGG - Intergenic
969022285 4:4146655-4146677 GAGCCACCCTCTGCCCTGCCAGG + Intergenic
969731588 4:8960738-8960760 GAGCCACCCTCTGCCCTGCCAGG - Intergenic
974044062 4:56882555-56882577 GAGTCTCGCTTTTGTCTCCCAGG + Intergenic
975858371 4:78649145-78649167 GAGCCACCATTTGTTCTCACTGG - Intergenic
983981708 4:174005652-174005674 GAGCCGCTCTCAGCTCTCCCAGG + Intergenic
985615532 5:918310-918332 GAGCCAGGCTCTGCTTTCCACGG - Intronic
991065098 5:62416206-62416228 GAGCCTCGCTCTTGTCTCCCAGG + Intronic
991965152 5:72083432-72083454 GTGCTATGCTTTACTCTCCCTGG + Intergenic
998308119 5:141099542-141099564 TAGCTATGCTTTGCTCTCTCAGG + Intergenic
1000254944 5:159528693-159528715 AAACCACACTCTGCTCTCCCAGG - Intergenic
1001683034 5:173572703-173572725 GAGCCAGCCATTGCTCCCCCTGG - Intergenic
1002884977 6:1285581-1285603 GAGCCAGGCATTGCTCTGCAGGG + Intergenic
1003047434 6:2746757-2746779 ATGCCACGCTTTTCTCTCCAGGG - Intronic
1005294213 6:24408654-24408676 GAGCCACTTTTTGCTCTAACAGG + Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1008260621 6:49362087-49362109 TAGCCATGTTTTCCTCTCCCTGG + Intergenic
1019560672 7:1654980-1655002 GAGCCACGGCCTGCCCTCCCGGG - Intergenic
1020110274 7:5443892-5443914 GGGCCACGCTTGGCGCTCCTGGG - Intronic
1022104720 7:27189595-27189617 GGGCCACCCTCTTCTCTCCCTGG + Intergenic
1024537579 7:50450659-50450681 GAGCCACGCTTTGCTCTCCCAGG - Intronic
1024537586 7:50450693-50450715 GAGCCATTGTTTGCTCTCCCGGG - Intronic
1026859212 7:73774214-73774236 GAGCCTGGCTTTGCTCTCCTGGG + Intergenic
1027342451 7:77223567-77223589 AAGGCACACTTTGCTCTTCCAGG + Intronic
1030030891 7:105368592-105368614 GAGCCACGCTCTGCTGGCCACGG + Intronic
1032441505 7:131945945-131945967 GTCCCAGGCTTTGCACTCCCAGG - Intergenic
1034410424 7:150938505-150938527 GCACCAGGCTCTGCTCTCCCAGG + Intergenic
1034485126 7:151355775-151355797 GAGCCACGCCTTGTTCTTCAAGG - Exonic
1038330274 8:26602873-26602895 AAGCCTCTCTTGGCTCTCCCAGG - Intronic
1043441409 8:80279768-80279790 GAGCCTCCCTCTGTTCTCCCTGG - Intergenic
1044824532 8:96183658-96183680 CAGCCACGCCTTGGTCTCCCTGG + Intergenic
1045942618 8:107756232-107756254 GAGTCATGCTTTGCTCCCTCAGG + Intergenic
1048793702 8:138129036-138129058 GGGGCAGGCCTTGCTCTCCCAGG + Intergenic
1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG + Intronic
1050233254 9:3551229-3551251 GAGCCGCCCTTTGCTCTTCAAGG - Intergenic
1052337430 9:27334847-27334869 GAGTCTCGCTTTGTTCCCCCAGG + Intronic
1056621931 9:88221784-88221806 GAGACATGCTTTAGTCTCCCAGG - Intergenic
1059559307 9:115316939-115316961 CAGCCACCCTTAGCTCTCACTGG + Intronic
1060423099 9:123483437-123483459 GACCCAGGCTTTGCTCTGCTTGG - Intronic
1062414888 9:136443321-136443343 GAGCCAGGCTGGGCCCTCCCCGG - Intronic
1188111287 X:26198277-26198299 CAGCCACTCATTCCTCTCCCTGG + Intergenic
1194488852 X:94521946-94521968 AAGCCACACTTTGTTCTCCGTGG - Intergenic
1195343815 X:103928701-103928723 GGGCCAGGCCTTGCTCTGCCAGG - Intronic
1195993996 X:110713052-110713074 GAGCCAATCTTTCCTCACCCTGG + Intronic
1199700444 X:150371540-150371562 GACCCACACTTTCCTCTCACAGG - Intronic
1200940630 Y:8776413-8776435 GAGCCACACCTTCCTCTACCGGG + Intergenic
1201907852 Y:19103697-19103719 GAGCTATTCTTTGTTCTCCCAGG + Intergenic