ID: 1024538163

View in Genome Browser
Species Human (GRCh38)
Location 7:50455490-50455512
Sequence GGCAGTGAATTCTCCATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024538163_1024538166 9 Left 1024538163 7:50455490-50455512 CCTACAATGGAGAATTCACTGCC No data
Right 1024538166 7:50455522-50455544 AACACCTTCCACTTGCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024538163 Original CRISPR GGCAGTGAATTCTCCATTGT AGG (reversed) Intronic