ID: 1024538163 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:50455490-50455512 |
Sequence | GGCAGTGAATTCTCCATTGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1024538163_1024538166 | 9 | Left | 1024538163 | 7:50455490-50455512 | CCTACAATGGAGAATTCACTGCC | No data | ||
Right | 1024538166 | 7:50455522-50455544 | AACACCTTCCACTTGCTGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1024538163 | Original CRISPR | GGCAGTGAATTCTCCATTGT AGG (reversed) | Intronic | ||