ID: 1024538166 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:50455522-50455544 |
| Sequence | AACACCTTCCACTTGCTGAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1024538163_1024538166 | 9 | Left | 1024538163 | 7:50455490-50455512 | CCTACAATGGAGAATTCACTGCC | No data | ||
| Right | 1024538166 | 7:50455522-50455544 | AACACCTTCCACTTGCTGATAGG | No data | ||||
| 1024538160_1024538166 | 27 | Left | 1024538160 | 7:50455472-50455494 | CCTATCTCCATTTGAGCACCTAC | 0: 1 1: 0 2: 0 3: 9 4: 108 |
||
| Right | 1024538166 | 7:50455522-50455544 | AACACCTTCCACTTGCTGATAGG | No data | ||||
| 1024538162_1024538166 | 20 | Left | 1024538162 | 7:50455479-50455501 | CCATTTGAGCACCTACAATGGAG | 0: 1 1: 0 2: 2 3: 6 4: 107 |
||
| Right | 1024538166 | 7:50455522-50455544 | AACACCTTCCACTTGCTGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1024538166 | Original CRISPR | AACACCTTCCACTTGCTGAT AGG | Intronic | ||