ID: 1024538166

View in Genome Browser
Species Human (GRCh38)
Location 7:50455522-50455544
Sequence AACACCTTCCACTTGCTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024538163_1024538166 9 Left 1024538163 7:50455490-50455512 CCTACAATGGAGAATTCACTGCC No data
Right 1024538166 7:50455522-50455544 AACACCTTCCACTTGCTGATAGG No data
1024538160_1024538166 27 Left 1024538160 7:50455472-50455494 CCTATCTCCATTTGAGCACCTAC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1024538166 7:50455522-50455544 AACACCTTCCACTTGCTGATAGG No data
1024538162_1024538166 20 Left 1024538162 7:50455479-50455501 CCATTTGAGCACCTACAATGGAG 0: 1
1: 0
2: 2
3: 6
4: 107
Right 1024538166 7:50455522-50455544 AACACCTTCCACTTGCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024538166 Original CRISPR AACACCTTCCACTTGCTGAT AGG Intronic