ID: 1024539150

View in Genome Browser
Species Human (GRCh38)
Location 7:50461800-50461822
Sequence GACCCAGAGCAACTCCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024539150_1024539151 1 Left 1024539150 7:50461800-50461822 CCACTTTGGAGTTGCTCTGGGTC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1024539151 7:50461824-50461846 GCAGTTCTTCCTCAGACCCCAGG 0: 1
1: 0
2: 0
3: 31
4: 271
1024539150_1024539159 29 Left 1024539150 7:50461800-50461822 CCACTTTGGAGTTGCTCTGGGTC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1024539159 7:50461852-50461874 CTCAGCTTATGAGTAGGGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 151
1024539150_1024539157 24 Left 1024539150 7:50461800-50461822 CCACTTTGGAGTTGCTCTGGGTC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1024539157 7:50461847-50461869 TCTTTCTCAGCTTATGAGTAGGG No data
1024539150_1024539158 25 Left 1024539150 7:50461800-50461822 CCACTTTGGAGTTGCTCTGGGTC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1024539158 7:50461848-50461870 CTTTCTCAGCTTATGAGTAGGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1024539150_1024539156 23 Left 1024539150 7:50461800-50461822 CCACTTTGGAGTTGCTCTGGGTC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1024539156 7:50461846-50461868 GTCTTTCTCAGCTTATGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024539150 Original CRISPR GACCCAGAGCAACTCCAAAG TGG (reversed) Intronic
908751669 1:67430105-67430127 GGCCCAGACCAACTCCAACGCGG - Exonic
910474443 1:87591748-87591770 GACCCAGAGCCACTCCCTACTGG - Intergenic
911008516 1:93253483-93253505 GTCCCAGAGCAGATCCCAAGGGG - Intronic
914459408 1:147869240-147869262 GCCCCTGGGGAACTCCAAAGTGG + Intergenic
914899541 1:151704440-151704462 AAACCAGAGCAACTCCCAAGAGG + Intronic
916473780 1:165148957-165148979 GCCCCCAAGCAACTCCAAATAGG + Intergenic
918666819 1:187161762-187161784 GACCAAGAGCATCTCAACAGAGG + Intergenic
919464337 1:197912051-197912073 GAAACAGATCAACTCCAACGGGG + Intronic
921875485 1:220191183-220191205 GACCCTGAGAATTTCCAAAGGGG + Exonic
922747835 1:228056058-228056080 GACTCTGACCAACTCAAAAGAGG + Intronic
923436756 1:233974784-233974806 GTCCCAGAGAAACTGAAAAGAGG + Intronic
1062834932 10:629313-629335 GATCCGGGCCAACTCCAAAGCGG + Intronic
1063479796 10:6365398-6365420 GAACCAGAACAAAGCCAAAGCGG + Intergenic
1068372324 10:56132729-56132751 GTCAAAGAGAAACTCCAAAGAGG - Intergenic
1068514558 10:58009726-58009748 GGTCCAGAACAAATCCAAAGAGG + Intergenic
1068522194 10:58089818-58089840 CAGCCAGACCAACTGCAAAGTGG - Intergenic
1070214527 10:74363282-74363304 GTCCCACAGCAAATCCCAAGGGG - Intronic
1073901237 10:108223633-108223655 GACCCAGAGAAAATACAAAAGGG + Intergenic
1074051568 10:109885638-109885660 GACCCAGGGCAACTGAGAAGAGG - Intronic
1076301089 10:129426878-129426900 CACTCAGAGCAGCTGCAAAGAGG - Intergenic
1080045815 11:27806412-27806434 GACCCATAGCAACTCGGAGGTGG + Intergenic
1080241283 11:30129695-30129717 GAACCAAAGCAAATCCAAAATGG + Intergenic
1080288594 11:30644935-30644957 GAACCAGAGCAACTCCATCTTGG + Intergenic
1081118792 11:39238055-39238077 CACACAGAGCATCTCCAAATAGG + Intergenic
1082067463 11:47912325-47912347 GACCCAGAGAAACTGCAGTGGGG + Intergenic
1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG + Intergenic
1090032414 11:123218511-123218533 GAACCAGAGCAACTTCATTGTGG + Intergenic
1090260253 11:125314320-125314342 GACCCAGAGCAGATCCAAACTGG - Intronic
1091073449 11:132591183-132591205 TTTCCACAGCAACTCCAAAGGGG - Intronic
1091450691 12:570455-570477 GACTGGGAGCAACTCCACAGGGG + Intronic
1092951289 12:13506002-13506024 GACCCAGATCAAAACCTAAGCGG + Intergenic
1097029596 12:56081330-56081352 GTCCCAGAGACACCCCAAAGGGG - Intronic
1097035791 12:56122635-56122657 GACCCAGAACAAGACCAAATGGG + Exonic
1098014356 12:66088630-66088652 AACTCAGAGCAGCTCCACAGGGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103993212 12:124812851-124812873 TAACCAGAGCCACTACAAAGGGG + Intronic
1104154956 12:126122340-126122362 GACCAAGGGCATGTCCAAAGAGG + Intergenic
1105937438 13:25115258-25115280 GACCCAGAGGAATACCAAGGGGG + Intergenic
1106133861 13:26960083-26960105 GACCCAGCTCATCTGCAAAGAGG - Intergenic
1106466801 13:30021013-30021035 GACCCAGAGCTTCTCCCAGGAGG - Intergenic
1106538643 13:30670832-30670854 GTTCCAGAGCAACTCCATGGTGG + Intergenic
1113973271 13:114207015-114207037 GACCCAGTGCAATTCCTGAGGGG + Intergenic
1118304027 14:64639608-64639630 GAACCAGAGCAACTCTGAACAGG - Intergenic
1125834699 15:42738584-42738606 GAACCAGAGCAACTCTCAGGAGG - Intergenic
1129148706 15:73673115-73673137 GACACAGGACAACTCGAAAGAGG + Intergenic
1132859642 16:2063729-2063751 GACCCAGAGGAACTTCCAGGAGG - Intronic
1134255894 16:12611162-12611184 GAACCAGAGCAACTCCATCTTGG + Intergenic
1135945023 16:26857955-26857977 AACCCCTATCAACTCCAAAGGGG + Intergenic
1139975634 16:70807876-70807898 GAGGCAGAGCCATTCCAAAGAGG + Exonic
1142124307 16:88402604-88402626 GACCCAGGTCAACTGCAAAGGGG - Intergenic
1144440794 17:15279464-15279486 GACCCAAGCCAACTGCAAAGGGG + Intergenic
1146707716 17:35013638-35013660 GACCAACAGCACCTCAAAAGAGG - Intronic
1151939846 17:77285697-77285719 GCCACAGAGAAACTCCAGAGTGG - Intronic
1152445654 17:80341274-80341296 GACCAACATCAACCCCAAAGAGG - Intronic
1154209215 18:12365121-12365143 GCCCCAGAGCAATCCCAGAGGGG + Intronic
1155216585 18:23648469-23648491 GACCAAGAGGACCTCCAATGAGG - Intronic
1155504082 18:26516061-26516083 GACAGACAGCAGCTCCAAAGAGG + Intronic
1157808916 18:50679329-50679351 GACCCAGAGCATTTGCAAATTGG - Intronic
1162784819 19:13028031-13028053 CACCCAACCCAACTCCAAAGAGG - Intronic
1164513962 19:28918479-28918501 GACCAAGAGGCCCTCCAAAGAGG + Intergenic
1167513854 19:49911422-49911444 GACCCAGAGAAACACCCACGAGG + Intronic
1168116073 19:54221962-54221984 GACTCACAGCAGCTCCACAGTGG - Exonic
1168119055 19:54241710-54241732 GACTCACAGCAGCTCCACAGTGG - Exonic
1168185489 19:54697358-54697380 GACTCACAGCAGCTCCACAGTGG + Intronic
925598618 2:5585217-5585239 GAGACAGAGAAACTCTAAAGAGG + Intergenic
928122274 2:28591784-28591806 GACCCAGGGCCCCTCCACAGGGG + Intronic
928283654 2:29970476-29970498 TCCCCAGAGCAACTCTAAGGAGG - Intergenic
928992777 2:37252529-37252551 GTAGCAGAGCAACTCCAAAAAGG + Exonic
931143661 2:59491384-59491406 GAACCAGAGCAACTCCATCTTGG - Intergenic
932798870 2:74722004-74722026 AACATAGAGAAACTCCAAAGTGG + Intergenic
934843375 2:97645790-97645812 GACCCACAGGAACTCCAATGTGG + Intergenic
937245399 2:120489172-120489194 GTCCCAGAGCAAGACAAAAGTGG + Intergenic
941012265 2:160313931-160313953 GAACCAGAGCATCTCTAAGGAGG - Intronic
947660604 2:231863700-231863722 CACCCAGAGCCTCGCCAAAGAGG - Intergenic
948156160 2:235783747-235783769 GGCCCAGAGGAACTCCTCAGGGG + Intronic
948723467 2:239918126-239918148 GCCCCAGAGCAGGTCCAAGGAGG - Intronic
948944746 2:241213813-241213835 GAGCCAGCCCAACTGCAAAGTGG + Intronic
1169256744 20:4105558-4105580 GACCCAGAGCCACGTTAAAGAGG + Intergenic
1169384483 20:5136617-5136639 GACCTAGAGCAAATCCTAACAGG - Intronic
1170440806 20:16377188-16377210 CACCCACAGCACCTCCTAAGGGG - Intronic
1170795926 20:19546663-19546685 GAATCAGAGAAACTCCAAATTGG - Intronic
1175962393 20:62643500-62643522 GTCCCACGGCAGCTCCAAAGAGG - Intronic
1179444536 21:41421994-41422016 CACCCAGAGCAACTCCACACCGG + Exonic
1181969421 22:26679151-26679173 GCCACAGAGCACCTACAAAGCGG - Intergenic
1183740698 22:39666983-39667005 GACCCAGAAATGCTCCAAAGGGG - Intronic
952686693 3:36158021-36158043 GACACAGGGCAACTTCACAGTGG + Intergenic
954750133 3:52808857-52808879 GACCCACAGCAGCTCAAAAGAGG + Exonic
967610092 3:191494854-191494876 AACCCAGAGTAACTGCACAGTGG - Intergenic
968657440 4:1784821-1784843 GGCCCAAAGCAGCTCCACAGGGG + Intergenic
969924867 4:10576200-10576222 GACCCAGATCCCCACCAAAGTGG + Intronic
970114017 4:12672677-12672699 GACACAGAGCACATTCAAAGTGG + Intergenic
971445350 4:26740693-26740715 TACCCACAGCAGGTCCAAAGGGG - Intronic
972663675 4:41143124-41143146 CACCCACAGCAACTCCAACCTGG + Exonic
975812272 4:78181851-78181873 GGCCCAGACCAACTCCAACGCGG - Intronic
979741991 4:124162461-124162483 GACCCAGAGCAAGCAAAAAGTGG + Intergenic
982069651 4:151684024-151684046 GACCCACAGCAAGTCAGAAGTGG - Intronic
983632930 4:169867914-169867936 GACCCAGAGCAGCTACACAAAGG - Intergenic
984937769 4:184904270-184904292 AGCCCAGAGCAACTCCTCAGGGG + Intergenic
986823199 5:11491698-11491720 GAACCAGAGCACTTGCAAAGAGG - Intronic
987049165 5:14135249-14135271 GATCAAGAGCAACTTAAAAGGGG - Intergenic
989527373 5:42468676-42468698 GACCCAGACCAACTCCAAGGCGG - Intronic
990237107 5:53780174-53780196 GACCAAGAGCAAGTTCAAAAGGG + Intergenic
991363507 5:65844720-65844742 GAACCAGAGCAACTCCATCTTGG - Intronic
992164485 5:74035835-74035857 GACTCAGAGCCACTCCCAAAAGG + Intergenic
993921234 5:93805741-93805763 GACCATGAGCAACTACAAATAGG - Intronic
995261160 5:110106097-110106119 GAACCACAGCAACTCCAACTTGG + Intergenic
996488256 5:124062035-124062057 AACCTAGAGCAACACCAAATTGG + Intergenic
997599796 5:135131491-135131513 GTCACACAGCAACCCCAAAGGGG - Intronic
998713717 5:144856277-144856299 GAGCCAGAGAAAATCCAAAGGGG - Intergenic
998781218 5:145658886-145658908 GACACAGAGTAACTGGAAAGGGG + Intronic
1002310759 5:178312481-178312503 GCCGCTGATCAACTCCAAAGGGG + Intronic
1005347592 6:24905685-24905707 GAGCTAGTGCAACTCCCAAGAGG - Intronic
1006799113 6:36748245-36748267 GACCCAGATCAACTTCACTGTGG - Exonic
1011301786 6:85882956-85882978 TACCCAGAGCAAGTCAAATGTGG + Intergenic
1012487998 6:99743559-99743581 GACCCAGGGCCACTCTAATGAGG + Intergenic
1015245070 6:131065686-131065708 AACCCAGAGCCACTCCAACCTGG - Intergenic
1017869473 6:158474579-158474601 GAGCCAGAGCAACAGCAAGGGGG - Intronic
1017937151 6:159015824-159015846 GACTCAGAGCTACTCCCCAGCGG - Intergenic
1018031582 6:159845571-159845593 GACACAGTTCAACTCCTAAGAGG - Intergenic
1019447200 7:1077461-1077483 GGACCAGAGCAACTTCAAATAGG - Intronic
1019524940 7:1476621-1476643 GGCCCAGAGGAAGTCCAGAGAGG + Exonic
1024323008 7:48088668-48088690 GTCCCAGAGAAACTCCCCAGGGG + Exonic
1024539150 7:50461800-50461822 GACCCAGAGCAACTCCAAAGTGG - Intronic
1029493155 7:100883171-100883193 GACACAGAGCAATTCGAGAGAGG - Intronic
1031176648 7:118361394-118361416 AACCCCTATCAACTCCAAAGGGG + Intergenic
1031452356 7:121937507-121937529 GAGCCCCAGCAACTCCATAGTGG + Intronic
1031987060 7:128170004-128170026 GTCCCAGAGCTTCTGCAAAGAGG - Intergenic
1032613359 7:133440479-133440501 GAACCAGAGCAACTCCATCTTGG + Intronic
1041007589 8:53510199-53510221 AACCTGGAGCACCTCCAAAGGGG + Intergenic
1041007634 8:53510602-53510624 AACCTGGAGCACCTCCAAAGGGG + Intergenic
1042521407 8:69715405-69715427 TGCCCAGAGGACCTCCAAAGAGG - Intronic
1047116264 8:121844682-121844704 AACACAGAGCAGCTACAAAGAGG + Intergenic
1048853239 8:138664070-138664092 GAGCCAGTGCATCTCCAAGGGGG - Intronic
1048937153 8:139366948-139366970 GACCCAGAGCAGCTTTAAACCGG + Intergenic
1049983509 9:926622-926644 TACACAGAGCAACTACACAGAGG + Intronic
1050942026 9:11471975-11471997 GACACAGAGGAGCTCCCAAGAGG - Intergenic
1051359809 9:16271954-16271976 AACCCAGAACAACTCTCAAGGGG + Intronic
1052744807 9:32430234-32430256 GACCCAGAGTATCTCCCATGGGG + Intronic
1053377614 9:37621323-37621345 CACCCAGAGGAACTCAAAACAGG + Intronic
1058592723 9:106582740-106582762 GACCCTCAGCACCTCCACAGGGG + Intergenic
1058914055 9:109548484-109548506 GACCCAGAGCAACACAGAAAAGG - Intergenic
1059555458 9:115276220-115276242 GACCCAGAGCACATCCAGAAAGG + Intronic
1062179347 9:135182583-135182605 GAGCCCCAGCAAATCCAAAGTGG + Intergenic
1185484349 X:470950-470972 GGCTCAGAGCATCCCCAAAGTGG + Intergenic
1186221211 X:7351161-7351183 GAACCACAGCATCTCCACAGTGG - Exonic
1188955762 X:36433823-36433845 AACCAAGAGCAACTCAGAAGAGG - Intergenic
1192160595 X:68783644-68783666 GGCCCAGACCAACTCCAACGCGG + Intergenic
1192636292 X:72822585-72822607 GAACCACAGAAACTCCAAAGAGG - Intronic
1192645422 X:72898229-72898251 GAACCACAGAAACTCCAAAGAGG + Intronic
1196496037 X:116326627-116326649 AAGCCAGAGCAAATCCAGAGAGG - Intergenic
1196906713 X:120444208-120444230 GACCCAGAGCAAAGGCAATGGGG + Intronic
1200406585 Y:2818141-2818163 AAGCCAGAGCAACCCCAAAATGG - Intergenic