ID: 1024542916

View in Genome Browser
Species Human (GRCh38)
Location 7:50493436-50493458
Sequence GGACCAGGCAGAGCATCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024542916_1024542920 2 Left 1024542916 7:50493436-50493458 CCTGTGGATGCTCTGCCTGGTCC 0: 1
1: 0
2: 1
3: 21
4: 177
Right 1024542920 7:50493461-50493483 CCGAACTCCAGCCACCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024542916 Original CRISPR GGACCAGGCAGAGCATCCAC AGG (reversed) Intronic
900369267 1:2324166-2324188 GGCCCAGGCAGGGCATTCAGGGG - Intronic
902166087 1:14572664-14572686 TGACCAGGCAGAGCATGTAGGGG + Intergenic
903257691 1:22113918-22113940 GGACCAGGCAGTGGCTCCTCTGG - Intergenic
903778897 1:25809478-25809500 GGTCCAGGCAGGGCTTCCAGAGG + Intronic
903808588 1:26022191-26022213 GGACCAGTCAGAGCTCCCACAGG - Exonic
904320837 1:29697037-29697059 GGCTCAGGAAGAGCTTCCACAGG - Intergenic
905888955 1:41507962-41507984 GGCTCAGGCAGAGAAGCCACAGG - Exonic
908474007 1:64470801-64470823 CGACCAGGCAGAGCAGCCAGAGG - Exonic
909475111 1:76073594-76073616 GGGACAGGCAGTTCATCCACAGG + Intergenic
910867453 1:91801401-91801423 TGGCCAGGGAGAGAATCCACTGG + Intronic
912366365 1:109137059-109137081 GGACCAGGCAGGGCATTCTGTGG + Intronic
913194944 1:116448509-116448531 GAACTAGGCAGAGCAGCAACAGG - Intergenic
915620990 1:157084044-157084066 AGACCAGGCAGGGCAACCACAGG - Intergenic
916720069 1:167478069-167478091 GGACCAGGCAAAGAATCAAAAGG + Intronic
920953722 1:210598320-210598342 TCACCAGCCAGAGCATCCAAGGG - Intronic
923218863 1:231875023-231875045 GATCCAGGCAGAGCATCATCAGG + Intronic
1064266558 10:13830190-13830212 CTGCCAGGCAGAGCATCCATCGG + Intronic
1064773828 10:18753365-18753387 TGACCAGGTAGAGAATCCGCTGG + Intergenic
1064981774 10:21173452-21173474 GGACCAGGCTGGGCACCCAGGGG - Intronic
1067945275 10:50685023-50685045 GGACGAGGCAGAGCACACGCTGG + Intergenic
1070866786 10:79711895-79711917 GGACGAGGCAGAGCACACACTGG + Exonic
1070880575 10:79850016-79850038 GGACGAGGCAGAGCACACACTGG + Exonic
1071633697 10:87234118-87234140 GGACGAGGCAGAGCACACACTGG + Exonic
1071647145 10:87366334-87366356 GGACGAGGCAGAGCACACACTGG + Exonic
1073424186 10:103446360-103446382 GGCCAAGGGAGAGCATCCAAAGG + Intergenic
1074200874 10:111234079-111234101 GTACCAGGAAGAAAATCCACTGG - Intergenic
1074230663 10:111531785-111531807 AGACCAAGAAGAGCATCCAGGGG - Intergenic
1076614842 10:131748413-131748435 GGGCCCGGCACAGCAGCCACGGG + Intergenic
1077154660 11:1085957-1085979 GGGCCAGGGACAGCATCAACAGG - Intergenic
1077316570 11:1922015-1922037 GGACCAGGGAAAGCGGCCACAGG + Intronic
1077486973 11:2843437-2843459 AGACCAGGCAGGGCCTCCCCAGG - Intronic
1078053515 11:7987569-7987591 GGACCAGGCAGAGCGGGCGCTGG - Exonic
1078104649 11:8351032-8351054 GGACCAGGCAAGCCATCCCCAGG - Intergenic
1083609704 11:63999042-63999064 GGCCCAGGCTGAGCAGCCCCTGG - Intronic
1084486075 11:69449121-69449143 GGACCATGCTGTGTATCCACGGG + Intergenic
1084804408 11:71569060-71569082 GGAACAGGAAGAGCCTACACAGG + Intergenic
1084806045 11:71579566-71579588 GGAACAGGAAGAGCCTTCACAGG - Intergenic
1085082987 11:73648993-73649015 GGACCTGTCAGAGGAGCCACGGG - Exonic
1089189926 11:116646303-116646325 GACCCAGGCAGGGCATCAACAGG + Intergenic
1090420501 11:126572077-126572099 GGACCAGGCTGAGCCTCCCCAGG - Intronic
1091750378 12:3018448-3018470 GGACCGGGCAGGGCCTCCACTGG - Intronic
1091855109 12:3733078-3733100 AGCCCAGCCAGAGCCTCCACTGG - Exonic
1099530414 12:83772598-83772620 GGGCCAGGAAAAGCCTCCACAGG - Intergenic
1102463591 12:113115156-113115178 GGACCAGGCGCAGCTTCCTCGGG - Intronic
1103468642 12:121162469-121162491 GCACCAGGCAGAGACTTCACAGG - Exonic
1103851653 12:123937326-123937348 GGGTCGGGCATAGCATCCACTGG + Exonic
1106512740 13:30425302-30425324 GACCCAGGCAGTGCATCCAATGG - Intergenic
1110551155 13:76812856-76812878 GCACCAGGCAGAGTATACAATGG + Intergenic
1113889181 13:113727009-113727031 GGACCAGGCAGAGAGGCCGCAGG - Intronic
1114625853 14:24129788-24129810 GGACCAGCCTGAGGAGCCACAGG - Intronic
1117046399 14:51817288-51817310 AGACCATGCACAGCATGCACAGG + Intergenic
1119719693 14:76882695-76882717 GAAGCAGGCAGGCCATCCACAGG - Intergenic
1122691404 14:103533609-103533631 GAACCCGGCAGAGCCTCCCCTGG + Intronic
1125524308 15:40365490-40365512 GGATCAGGCAGTCCATGCACAGG + Intronic
1125533532 15:40429195-40429217 GGCCATGCCAGAGCATCCACTGG - Intronic
1125599959 15:40910059-40910081 GGACCAGCTGGAGCCTCCACTGG + Intergenic
1127358714 15:58226415-58226437 GCAGCTGGCAGAGCATCCCCAGG - Intronic
1127643245 15:60934881-60934903 GGAACAGGCAGTGCAGCCAATGG - Intronic
1127795984 15:62438761-62438783 GGTCCAGGCATATCATACACAGG - Intronic
1128081605 15:64860504-64860526 GGGGCAGGCAGAGCATCCCATGG + Intronic
1130166933 15:81471004-81471026 AGACCAAGCAGGACATCCACAGG - Intergenic
1130387417 15:83423818-83423840 GGAACAGGCAGATCCTCCAAAGG - Intergenic
1132010282 15:98268943-98268965 GGACCGGGCAGAGCAGCGGCTGG + Intergenic
1133031536 16:3013509-3013531 GCACCACGCAGGACATCCACAGG - Exonic
1133032063 16:3015853-3015875 GCACCACGCAGGACATCCACAGG + Exonic
1133333427 16:4990664-4990686 GGCCCAGGCAGAGCCTGCAGTGG - Intronic
1141894063 16:86947232-86947254 TGACCACGCAGAGAATCCCCTGG - Intergenic
1143405640 17:6675524-6675546 GGACCACACAGCGCATCCACAGG + Intergenic
1143679503 17:8465879-8465901 GCACCATGCAGCGCAGCCACAGG - Intronic
1143902009 17:10181469-10181491 GGAACAGGAACAGCATGCACAGG + Intronic
1147036855 17:37688077-37688099 GGACCAGGGAAAGGATCCAAAGG + Intronic
1149866708 17:60155068-60155090 GGGCCAGGCCAAGCAGCCACTGG - Intronic
1151685207 17:75642231-75642253 GGTCCAGACAGAGCATCCCGAGG + Intronic
1152465894 17:80465993-80466015 GCACCGGGCAGAGAATCCCCGGG + Intergenic
1152647883 17:81478319-81478341 GGATCAGGCAGAGCAGTCTCCGG + Intergenic
1152687733 17:81702910-81702932 AGAACAGGCAGAGCCTCCAAGGG - Intronic
1156739503 18:40306007-40306029 GGACCTGTCGGAGAATCCACAGG - Intergenic
1157977098 18:52340087-52340109 GGATCAGGCAAAGATTCCACGGG - Intergenic
1158349766 18:56553056-56553078 GGATCATGGAGAGCATCCACTGG - Intergenic
1160308243 18:77761217-77761239 GGATCAGTCAGAGCTTCCCCAGG - Intergenic
1160369302 18:78358344-78358366 GAACCAGGCAGAGCATCTGCGGG + Intergenic
1160579922 18:79877885-79877907 GGGCCAGGCTGAGCAGGCACAGG - Intronic
1160729344 19:633669-633691 GAACCAATCAGAGCGTCCACCGG - Intergenic
1160957324 19:1699665-1699687 GGGCCAGGCTGAGCATACCCTGG - Intergenic
1162834413 19:13306899-13306921 GGACCAAGCAGAGAAGCAACAGG - Intronic
1165092047 19:33392695-33392717 GGACCATGCAGAGCAGGCTCTGG - Intronic
928972323 2:37043152-37043174 GGACAAGGCAGAGCTTTCAATGG + Intronic
931036672 2:58251668-58251690 GGACCAGGCAGAGCGGGCGCTGG - Intergenic
932188160 2:69716220-69716242 GGACTAGACAGAGCCACCACAGG - Intronic
933085752 2:78052712-78052734 GCCCCAGACAGAGCATCCAGGGG - Intergenic
935042150 2:99442350-99442372 GGACCTGGCAGAGGATCCTCAGG + Exonic
935216974 2:100982338-100982360 GGACCAGGCAGAGCTGCTCCTGG - Exonic
936099949 2:109568253-109568275 GGGCCAGGCTGAGAATACACTGG - Intronic
936976923 2:118229840-118229862 AGTCCAGGCAGAGAAGCCACTGG - Intergenic
937031122 2:118741510-118741532 GGACCAGGCAAAGCCTGCTCTGG - Intergenic
937908077 2:127062024-127062046 GGACCAGGGAGGGCACCAACAGG + Intronic
940186061 2:150985949-150985971 GGGCAGGGCAGAGCAGCCACTGG - Intergenic
941052430 2:160749765-160749787 GGATCTGGCAGAGCAGGCACTGG - Intergenic
942542255 2:177026606-177026628 GGACCCGGCACAGCTCCCACTGG - Intergenic
947545636 2:231008448-231008470 GGACCCAGCAGGGCAGCCACTGG + Intronic
948602438 2:239115106-239115128 GGAAGAGGCAGAGCCCCCACGGG - Exonic
1170019236 20:11817316-11817338 TGCCCAGGCAGAGCAACCTCTGG + Intergenic
1170386038 20:15818071-15818093 GGACCAGGAAAAGCCACCACAGG - Intronic
1172329411 20:34064592-34064614 GGACAAGGGAGAGCATGCATAGG + Intronic
1173642899 20:44615997-44616019 GGCCCAGGCAGAACCTCCACAGG + Intronic
1175349846 20:58309896-58309918 GGCCCAGCAAGAGCATCCCCTGG - Exonic
1179445386 21:41426858-41426880 GCCCCAGGCATGGCATCCACTGG - Intronic
1179718741 21:43303576-43303598 ACACAAGGCAGAGCAGCCACGGG - Intergenic
1179791695 21:43759596-43759618 GGCCCAGGCAGGCGATCCACAGG - Exonic
1179885579 21:44312935-44312957 GGACCTGGCTGAGGCTCCACTGG - Intronic
1180836901 22:18934451-18934473 GGAAGAGGCAGGGCATCCAGAGG - Intronic
1181652254 22:24266118-24266140 GGACCAGGCAGAGCACAAAGCGG + Intergenic
1181871058 22:25899689-25899711 GGTTCAGCCAGAGCACCCACAGG - Intronic
1182468561 22:30532959-30532981 GGGCCTGCCAGAGCATCCCCAGG + Intronic
1183618121 22:38957195-38957217 GGACCAGGCACATCCTGCACTGG + Intronic
1184220830 22:43098722-43098744 GGACCAGGCAGATATTCTACAGG - Intergenic
1184381164 22:44145616-44145638 GGACCAGGCACAGGACCCAAGGG - Intronic
1185081817 22:48713730-48713752 GGACAAGGCAAGCCATCCACTGG - Intronic
1203286994 22_KI270734v1_random:159750-159772 GGAAGAGGCAGGGCATCCAGAGG - Intergenic
949681546 3:6519984-6520006 GGCCCAGGCAGAGTTGCCACAGG - Intergenic
961484541 3:127207828-127207850 GGGCCAGGCAGAGCATCACTGGG - Intergenic
962255750 3:133869069-133869091 GGAGGAGGCAGGGCAGCCACGGG + Intronic
963797661 3:149647384-149647406 TGCCCAGGCAGGGCATCCTCAGG + Intronic
963920079 3:150896971-150896993 GGCCCAGTCAGAGCTTTCACAGG - Intronic
963964010 3:151345264-151345286 GGACAAGGAAAAGCATCAACTGG - Intronic
964639331 3:158892072-158892094 GGGCCAGGGGAAGCATCCACAGG + Intergenic
964887967 3:161506221-161506243 GAACCAGGCAGAGCACCCGTAGG + Intergenic
966871276 3:184291834-184291856 GACCCAGGCAGAGCCTCCGCTGG + Intronic
967820735 3:193836552-193836574 GCACCAGGCAGACTATGCACAGG - Intergenic
968433646 4:574549-574571 CCACCAGGCAGAGCAGCCCCAGG + Intergenic
968711774 4:2124745-2124767 GGACAAGTCAAAGCCTCCACAGG - Intronic
968961932 4:3750062-3750084 GGACCAGGCAGAGGACCCAGAGG + Intergenic
969345782 4:6569041-6569063 GGAGCAGGCAGAAAACCCACTGG + Intergenic
970035068 4:11723843-11723865 GGCCCAGGAGGAGCATCTACCGG - Intergenic
970354395 4:15237684-15237706 GGAGAAGGCAGAGCTGCCACTGG + Intergenic
973877068 4:55230469-55230491 GGACCAGGCTGAGCAGTCACAGG - Intergenic
978615345 4:110588071-110588093 GGACCTTGCGGAGCAGCCACAGG + Intergenic
979174954 4:117651706-117651728 TTACCAGGCAGAGCACCCCCTGG - Intergenic
979224269 4:118265976-118265998 GGTCCAGGTACAGGATCCACTGG + Intergenic
983425787 4:167581978-167582000 GGCCCTGGCACAGGATCCACTGG + Intergenic
985766269 5:1781339-1781361 GGACCTGGCAGAGCAGCCTTGGG + Intergenic
987360980 5:17106248-17106270 GTGCCAAGCAGAGTATCCACAGG - Intronic
988744720 5:34123118-34123140 GGTCCAGGCAGAGAACCCACAGG + Intronic
991085739 5:62646975-62646997 GGACCAGGCAGTGCATGCACGGG - Intergenic
995213436 5:109567685-109567707 GGACCTAGAAGAGTATCCACAGG + Intergenic
997383284 5:133452747-133452769 GTCCCTGGAAGAGCATCCACTGG - Intronic
997435139 5:133868377-133868399 GGAGCAGGCAGAGCATGGAATGG - Intergenic
1000339633 5:160267038-160267060 GCAAGAGGCAGAGAATCCACTGG + Intronic
1001527692 5:172440408-172440430 GATCCAGGCACAGCATCCCCAGG - Intronic
1001587874 5:172845426-172845448 GGACTGGCCAGAGCATCCTCCGG - Intronic
1002331155 5:178441942-178441964 TGACCAGGCAGAGGGTCCAGTGG + Intronic
1004005536 6:11634209-11634231 GGACCAAGCAGGGCTTCCATGGG + Intergenic
1006342726 6:33455431-33455453 TGAGCAGGAAGAGCATCCAGTGG - Exonic
1008555360 6:52668648-52668670 GGAGCAGGCTCAGGATCCACAGG + Intergenic
1008631041 6:53363387-53363409 GGCCCTGGCACAGGATCCACTGG - Intergenic
1010898238 6:81392591-81392613 GTACCACACAGAGCCTCCACTGG + Intergenic
1012232459 6:96776388-96776410 GGACCAGACAGAACATCCTGTGG - Intergenic
1015274814 6:131373354-131373376 GAACCATGCAGAGCAGTCACAGG - Intergenic
1015819960 6:137250117-137250139 GGATAAGGGAGAGCCTCCACCGG - Intergenic
1019179932 6:170180117-170180139 GGACCAGGCAGAGCAGCAATTGG + Intergenic
1019274387 7:168221-168243 GGCCCAGCCAGAGAAGCCACGGG - Intergenic
1019513922 7:1431501-1431523 GGACCAAGCAGAGTCTCCACTGG - Intronic
1019916438 7:4135861-4135883 GGACCAGGCTGAGCCCCCAATGG - Intronic
1020260039 7:6526144-6526166 TGACCCGGCAGAGCCACCACGGG + Intronic
1024542916 7:50493436-50493458 GGACCAGGCAGAGCATCCACAGG - Intronic
1026807224 7:73435980-73436002 GGACCAGGCTGAGTCCCCACAGG + Exonic
1026827161 7:73591625-73591647 GGAACCGACAGGGCATCCACTGG - Intergenic
1026858450 7:73769884-73769906 GCACCACGCAGTTCATCCACAGG + Exonic
1029272586 7:99385830-99385852 GGACCAGCCAGAGCACACATGGG + Intronic
1034093128 7:148382247-148382269 GGAACAGGGAGAGAAACCACGGG - Intronic
1034271096 7:149803738-149803760 GGACCAGGCTGACCAGCCGCAGG - Intergenic
1034438726 7:151076045-151076067 GGGCCAGGCAGAGCAGCTGCAGG - Exonic
1035482551 7:159198877-159198899 TGACCAGGCAGAGCCTCGCCTGG + Intergenic
1035657918 8:1325052-1325074 ATGCCAGGCAGAGCATCCATCGG - Intergenic
1036761198 8:11509581-11509603 AGACCCGGCAGAGCACCCCCAGG - Intronic
1037395494 8:18437458-18437480 CCACCAGGCTGTGCATCCACCGG + Intergenic
1037843244 8:22260577-22260599 GGAGCAGGCAGTTCATCCATAGG - Intergenic
1038442857 8:27583960-27583982 GGCCATGGCAGAGCTTCCACAGG - Intergenic
1038840542 8:31180751-31180773 GCACCAGGATGAGCACCCACTGG - Intergenic
1040071367 8:43191518-43191540 GCACCAGGATGAGCAGCCACTGG - Exonic
1042671335 8:71266743-71266765 GGACCAGGCAAGGAAACCACTGG - Intronic
1047807866 8:128378180-128378202 GGAGAAGCCAGGGCATCCACTGG + Intergenic
1048306830 8:133290273-133290295 CCACCAGGAAGAGCAGCCACAGG + Intronic
1049356211 8:142189765-142189787 GCACCAGGCAGACCAGCCGCTGG + Intergenic
1049578640 8:143400928-143400950 GGTCCAGCCACAGCATCCATCGG + Intergenic
1050125424 9:2352485-2352507 TGACCAGGGTGAGCATCCACAGG + Intergenic
1055577243 9:77672183-77672205 GGCCCATGCAGTGCAACCACAGG + Intergenic
1056760476 9:89411104-89411126 GGAGCAGGCAGAGGCTCCAATGG + Intronic
1056899398 9:90584020-90584042 GGACCACCCAGGGTATCCACAGG - Intergenic
1057802361 9:98198160-98198182 GGACCAGCCAGGGCCACCACGGG + Intergenic
1058869530 9:109190401-109190423 GGCCCAGAGAGAGCAGCCACAGG + Intronic
1059403975 9:114088773-114088795 GGACCAGGCAGAGCAGGCTGTGG - Intronic
1061957358 9:133970535-133970557 GGACCAGGTACACCAACCACAGG - Intronic
1062722836 9:138053482-138053504 GGACCAGGCAGGGCACCTACGGG - Intronic
1188154417 X:26723113-26723135 GTACCATGCATACCATCCACAGG + Intergenic
1188363269 X:29282938-29282960 AGACCAGTCAGTGCATCCATCGG - Exonic
1192848019 X:74925573-74925595 GGACCAGGCAGTGCCTGCAGAGG - Intergenic
1198413390 X:136394395-136394417 GTTCCAGGCAGAGTTTCCACAGG - Intronic
1200062270 X:153488890-153488912 GGGCCAGGCAGGCCACCCACAGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic