ID: 1024543745

View in Genome Browser
Species Human (GRCh38)
Location 7:50500162-50500184
Sequence ACCCCACGGTACCCTGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024543745_1024543751 9 Left 1024543745 7:50500162-50500184 CCAGTGTCAGGGTACCGTGGGGT 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1024543751 7:50500194-50500216 GGTCAGCATATGCATTTGTAGGG No data
1024543745_1024543752 17 Left 1024543745 7:50500162-50500184 CCAGTGTCAGGGTACCGTGGGGT 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1024543752 7:50500202-50500224 TATGCATTTGTAGGGATCCATGG 0: 1
1: 0
2: 0
3: 10
4: 141
1024543745_1024543750 8 Left 1024543745 7:50500162-50500184 CCAGTGTCAGGGTACCGTGGGGT 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1024543750 7:50500193-50500215 GGGTCAGCATATGCATTTGTAGG 0: 1
1: 0
2: 0
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024543745 Original CRISPR ACCCCACGGTACCCTGACAC TGG (reversed) Intronic
900366305 1:2313266-2313288 TCCCCACGGTTCCCTGTCCCTGG - Intergenic
900483103 1:2908882-2908904 ACGCCAAGGTCCCCTGACAGTGG - Intergenic
903957123 1:27033250-27033272 CTCCCACGGTACCCAAACACAGG - Intergenic
907484256 1:54766162-54766184 ACCCCATGCTTCCCTCACACTGG - Intergenic
1068055278 10:52005467-52005489 ACCCCACCCAACCCTGCCACTGG + Intronic
1069562231 10:69439010-69439032 ACCCCTAGGCACCCAGACACTGG + Intergenic
1087606417 11:100383779-100383801 ACCCCAGTGTTCCCTGACAAAGG + Intergenic
1104645104 12:130491695-130491717 ATCCCACCACACCCTGACACCGG + Intronic
1104919844 12:132285085-132285107 CCGCCAGGGAACCCTGACACCGG - Intronic
1113567146 13:111326001-111326023 TCCCCACCGTCCCCAGACACGGG - Intronic
1121434994 14:93913304-93913326 ACCCCACGGGACCTTAACACAGG - Intergenic
1128054662 15:64690644-64690666 ATCCCACGCTACCCTGACACTGG - Intronic
1128802430 15:70505197-70505219 CCCCCACGGCACCCCAACACGGG + Intergenic
1130018921 15:80210806-80210828 ACCCCACTGGACCCTGACCTGGG - Intergenic
1132646318 16:1000857-1000879 AGCCCCCGGGACCCTGACACTGG + Intergenic
1145761938 17:27430199-27430221 GCCCAAGGGGACCCTGACACCGG + Intergenic
1150736975 17:67749362-67749384 ACGCCACGGTACCCTTAGCCTGG - Intergenic
1153523995 18:5977887-5977909 GCCCCTGGGTACCCTGCCACTGG + Intronic
1160856109 19:1218702-1218724 ACCCCACGGGCCCAAGACACAGG - Intronic
1161293514 19:3507819-3507841 AACACACGGGCCCCTGACACAGG - Intronic
1161361778 19:3854088-3854110 AAACCACTGTGCCCTGACACAGG + Intronic
1161738142 19:6004284-6004306 TCCCCCAGGTACCTTGACACAGG - Exonic
1165112068 19:33508264-33508286 AGCCAAGGGTACCCTGGCACAGG + Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1167574191 19:50309847-50309869 ACCCCACGGGCCCCTGTCCCAGG + Exonic
1168130013 19:54312056-54312078 CCTCCAGGGTCCCCTGACACCGG + Exonic
927016615 2:18969975-18969997 ACCCCAGGGGACCCTTGCACAGG + Intergenic
927636657 2:24821640-24821662 TCTCCACGGTCCCCTGGCACAGG - Exonic
928090771 2:28373631-28373653 ACCCCAGGTTACCCTGCAACTGG + Intergenic
929171233 2:38934943-38934965 TTCTCACGGGACCCTGACACTGG - Intronic
942293845 2:174499045-174499067 AGCCCAGGGTAGCCTAACACAGG - Intergenic
944305055 2:198169698-198169720 TCCCCAGGGTACCTTGACACTGG - Intronic
949050558 2:241895412-241895434 ACCCCACGGTCCCCTGTAAAGGG - Intronic
1174107122 20:48170726-48170748 AACCCAGGGAATCCTGACACTGG + Intergenic
1176305048 21:5118917-5118939 ACCCCAGGCTGCCCTGCCACGGG + Intronic
1179842895 21:44088831-44088853 ATCCCACTCTTCCCTGACACTGG + Intronic
1179852007 21:44143113-44143135 ACCCCAGGCTGCCCTGCCACGGG - Intronic
1180225096 21:46387488-46387510 AGCCCACGGTCCCTGGACACTGG + Intronic
1181570388 22:23765072-23765094 AACACACTGTACCCTGAGACAGG + Intronic
1182774927 22:32823858-32823880 TCCCCACAGTGCCCTGCCACAGG + Intronic
1184243213 22:43222420-43222442 CTCCCACGGTCCCCTGACCCTGG + Intronic
1184952640 22:47855165-47855187 ACCCTACGGGGCCTTGACACTGG + Intergenic
956196345 3:66656884-66656906 ACCCCCCTGTCCCCAGACACAGG + Intergenic
956492084 3:69783765-69783787 TCCCCAGGTGACCCTGACACAGG - Intronic
968997825 4:3956278-3956300 AGCCCACGGTCTGCTGACACGGG + Intergenic
976934517 4:90613053-90613075 ACCCAACGGTACACAGGCACTGG + Intronic
982199967 4:152950585-152950607 AGCCCACGGTGCCCCAACACAGG - Intronic
985898204 5:2763173-2763195 ACCCCAGGAGGCCCTGACACAGG + Intergenic
989536889 5:42574239-42574261 GCCAAACGGTGCCCTGACACAGG - Intronic
989560079 5:42840567-42840589 ACCCCATGGCAGCCTGCCACTGG - Intronic
991639655 5:68739685-68739707 ACCTCAGGGTACCCTGATGCTGG - Intergenic
1001280652 5:170384003-170384025 ACCCCACAGTCCCCGGACACAGG + Intronic
1002183389 5:177442765-177442787 ATCCCATGCTACCCTAACACTGG - Intronic
1002269044 5:178057750-178057772 ACCGCATGGTCCCGTGACACAGG + Intergenic
1008033307 6:46720511-46720533 ACCCCCAGGCACCCTGGCACTGG - Intronic
1010147248 6:72684272-72684294 ATCCCACGCTTCCCTGACACTGG + Intronic
1019639763 7:2097126-2097148 ACCCCATGGCACCCAGGCACAGG + Intronic
1024543745 7:50500162-50500184 ACCCCACGGTACCCTGACACTGG - Intronic
1035222135 7:157412283-157412305 ACCCACCAGCACCCTGACACCGG - Intronic
1035228379 7:157445860-157445882 ACCCCCCAGTACCATCACACTGG - Intergenic
1039003222 8:33005028-33005050 ACCCCACTCTACCTTGACCCAGG - Intergenic
1044971651 8:97625835-97625857 ACTCCTCAATACCCTGACACTGG + Intergenic
1048314654 8:133353040-133353062 ACTCCATGGTATCCTGCCACAGG - Intergenic
1049479066 8:142811362-142811384 ACCCCACATTCCCCTGGCACAGG - Intergenic
1053362382 9:37498043-37498065 AGCCCATCTTACCCTGACACAGG + Intronic
1057954956 9:99400196-99400218 ACCACACTGAACCCTGACAAGGG - Intergenic
1060030637 9:120212140-120212162 ACCCCACCCCACCCTGACCCAGG + Intergenic
1061578767 9:131524024-131524046 ACCCCAGGCAACCCAGACACGGG + Exonic
1062546097 9:137064367-137064389 ACCCCACTGTCCACTGACAGCGG + Exonic
1191255852 X:58279283-58279305 AGCCCGGGGTGCCCTGACACAGG - Intergenic
1200021854 X:153218509-153218531 ACCCTACGGGGCCTTGACACTGG - Intergenic