ID: 1024548461

View in Genome Browser
Species Human (GRCh38)
Location 7:50541094-50541116
Sequence CAGCCTGAGAGGGGTCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024548461_1024548465 -9 Left 1024548461 7:50541094-50541116 CCATTCAGACCCCTCTCAGGCTG 0: 1
1: 0
2: 1
3: 19
4: 212
Right 1024548465 7:50541108-50541130 CTCAGGCTGTGACCACGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024548461 Original CRISPR CAGCCTGAGAGGGGTCTGAA TGG (reversed) Intronic
900338764 1:2177846-2177868 CAGCCTGAGAGGCCTGCGAAGGG + Intronic
900989253 1:6090505-6090527 AGGCCTGGGCGGGGTCTGAAGGG + Intronic
901821674 1:11834407-11834429 GAGCCTGACAGGGGCCTGGAGGG - Intronic
902767331 1:18626117-18626139 CAGCCTGAGAAGGAGATGAAGGG + Intergenic
903324032 1:22559464-22559486 CACTCTGTGAGGGGTCTCAAAGG - Intergenic
904008530 1:27376601-27376623 CACCCTGTGAGTTGTCTGAATGG - Intergenic
904235733 1:29115845-29115867 CAGCCTGAGAGGGCTCTGGATGG + Intronic
905470729 1:38189782-38189804 AAGTCTGAGATGGGTCTCAATGG + Intergenic
907174335 1:52504281-52504303 AAGCCTGAGAAGGGTCTGTTTGG - Intronic
909023493 1:70458186-70458208 CAGCCAGCTTGGGGTCTGAAGGG + Intergenic
910047084 1:82931043-82931065 AAGACTCAGAGGAGTCTGAAAGG - Intergenic
912548110 1:110465743-110465765 GAGCCTGTGAGGGGTCTCAGGGG + Intergenic
912936186 1:114005442-114005464 CAGCCTGTGTGGGGCCTGATAGG - Intergenic
913555963 1:119967484-119967506 CATTCTGGCAGGGGTCTGAATGG + Exonic
915235052 1:154474302-154474324 CAGCCAGAGATGGGTCTCAAAGG + Intronic
916204343 1:162300761-162300783 CAGCCTGACAGGTGGCTGTAGGG - Intronic
920311157 1:205049070-205049092 CAGCCTTAGAGGAGACTGCAGGG - Intronic
920570831 1:207016130-207016152 CAGGCTGGGATGGGTGTGAAGGG - Intronic
920671882 1:208009977-208009999 AAGCCTGAGAGGAGTCTGCAGGG + Intergenic
921229388 1:213052837-213052859 CAGCCTGAGAAGAATCTTAAAGG + Intronic
921894028 1:220380266-220380288 CATCCTGAGAGGGGCCTGGTGGG + Intergenic
923974960 1:239252155-239252177 AAGCCAGAGAGGGATTTGAAAGG + Intergenic
924530371 1:244888778-244888800 AAGTCTGAGAGGGGTCTCACTGG - Intergenic
1062901364 10:1149146-1149168 CAGCATCAGAGGGGTCAAAAAGG - Intergenic
1062956199 10:1542012-1542034 GAGTCTGAGTGGGGTCTGGACGG - Intronic
1063536704 10:6890896-6890918 GAGCCTGTGTGGGGCCTGAAGGG - Intergenic
1064284553 10:13981405-13981427 CAGACTGAAAGGTGTATGAAAGG + Intronic
1066058012 10:31699454-31699476 CACCATGGGAGGGATCTGAATGG + Intergenic
1068003988 10:51371123-51371145 CAGCCTGATAAGGGTCTATAAGG + Intronic
1069885053 10:71618411-71618433 CAGGCTGAGAGGGTCCTGAAGGG - Intronic
1070707003 10:78647032-78647054 AAGCCAGACAGGGATCTGAATGG - Intergenic
1071080332 10:81802802-81802824 CAGCATGAGAGGTGTTTGAGGGG - Intergenic
1074391029 10:113058294-113058316 CAGCCTGAGCAGGCTCTGAATGG + Intronic
1074823665 10:117199655-117199677 CAGCCTGAGATGGTGGTGAAAGG - Intronic
1074852434 10:117449454-117449476 CAGTCTGAGAGGGGGCTTCATGG + Intergenic
1074972116 10:118547734-118547756 CAGCAGGAAAGGGGTCTGGAAGG + Intergenic
1075571418 10:123549143-123549165 CAGGCTGAGATGGGGCAGAATGG - Intergenic
1076009631 10:126977198-126977220 CAGCCTGAGAGGGGTGCCAGGGG + Intronic
1076095780 10:127734233-127734255 AGGCCTGAGAGGGGTGTGGAGGG + Intergenic
1076279322 10:129232487-129232509 CAGGCTGATGGGGGTCTGCAGGG - Intergenic
1076463514 10:130662428-130662450 CAGCATGAGAGGAGGCTGCATGG + Intergenic
1076630156 10:131847479-131847501 CTGCCTGTGAGGGGTGTGGACGG + Intergenic
1076906192 10:133362672-133362694 CAGCCTGTGAGGGTCCTGACTGG - Exonic
1081579854 11:44344773-44344795 CTGCCTGATGGGGGTCTGCAGGG - Intergenic
1081810811 11:45913299-45913321 CAGCCTGAGAGAGGCCTGCTGGG - Intronic
1083270615 11:61570371-61570393 CAGGGTGAGAGGGTTCTGCAAGG + Intronic
1083789754 11:64976865-64976887 CAGCCAGAGACTGGTCTGACGGG + Intergenic
1083978643 11:66145534-66145556 CAGTTACAGAGGGGTCTGAAGGG + Intronic
1084214784 11:67641437-67641459 CAGCCGGGGAGGGGTGTGCAGGG - Intergenic
1084672658 11:70616365-70616387 CAGCCTGGGAGGGGCCTGGATGG + Intronic
1085177416 11:74502757-74502779 GAGTCTGGGAGGGTTCTGAATGG + Intronic
1085707368 11:78798776-78798798 GACCCTGAAAGGGGACTGAAGGG - Intronic
1086662204 11:89432830-89432852 TGGCCTGACAGGGGTCTGCATGG - Exonic
1086729462 11:90229385-90229407 CAGCCTGAGAGGCAGCTGTAAGG + Intergenic
1086946476 11:92848850-92848872 CTGCCTGAGCAAGGTCTGAAAGG + Intronic
1089737156 11:120557343-120557365 CAGCCTGTGAGGAGACTGGATGG - Intronic
1090442635 11:126737097-126737119 CTGCCTGAGAGGGTGCTGAGTGG + Intronic
1091282779 11:134391402-134391424 CAGTCTGAGACGGGGCTGCAAGG + Exonic
1091368006 11:135038025-135038047 CAGACTGGAAGGGGCCTGAATGG - Intergenic
1091628416 12:2140096-2140118 CAGTGAGAGAGGGGTCTGCAGGG - Intronic
1092121869 12:6050060-6050082 CAGCTTGAAATGGGTCTGGAAGG - Intronic
1092916754 12:13196382-13196404 CAGCCTGGGAGGGGGAGGAAAGG - Intergenic
1093958686 12:25250587-25250609 CTGGGTGAGAGGGGTCTGCAGGG - Intronic
1096473673 12:51895297-51895319 CAGCCTGAAAGGGTTCTGGGAGG - Intergenic
1101660707 12:106763054-106763076 CAGCCTGATAGAGGTTTGTAGGG + Intronic
1102390833 12:112547309-112547331 AAGCCAGAGAGGGGTGTGGAGGG + Intergenic
1102536242 12:113583553-113583575 CAGCCTGAGAAGGGAAGGAAAGG - Intergenic
1103699825 12:122843232-122843254 CCGCCTGGGAGGGGCCTGAGGGG + Intronic
1103944056 12:124516583-124516605 GAGCCTGAGAGAAGCCTGAAGGG - Intronic
1104589300 12:130071316-130071338 CACACAGAGAGGGTTCTGAAAGG + Intergenic
1104902617 12:132197567-132197589 CAGCCAGAGAGGGGTCGGGCTGG - Intronic
1106734190 13:32572367-32572389 CATCCTGAGATGGGTCTGGTTGG - Intergenic
1107110137 13:36688508-36688530 CAGCCTGAGAATTTTCTGAAAGG + Intronic
1117480464 14:56139007-56139029 CAGCCTGACAGGGTACTGGAGGG + Intronic
1118985487 14:70751032-70751054 CAGCGTGAGTGGGTTCTTAACGG + Intronic
1119181838 14:72610690-72610712 CAGCCTGAGAGCGCGCTCAAGGG + Intergenic
1122004721 14:98692671-98692693 AAGCCTGAGAGAGGACTGCAAGG + Intergenic
1124027647 15:25981736-25981758 CAGCCTGCAGGGGGTCTGCAGGG + Intergenic
1124368073 15:29088055-29088077 GAGCCAGAGAGGGGGCTGAGAGG - Intronic
1126233019 15:46349550-46349572 GAGTCTGAGAATGGTCTGAATGG - Intergenic
1127873303 15:63091036-63091058 CAGCCTGAGAGAGGGCAGAAGGG - Intergenic
1128367427 15:67014159-67014181 CATTCTGAGAGGGGTTAGAAAGG + Intergenic
1128451822 15:67810254-67810276 CTGTTTGAGAGGGGCCTGAAAGG - Intergenic
1129754907 15:78092344-78092366 CAGCCTGAGAGGGGTAGGGAAGG - Intronic
1132312049 15:100864364-100864386 CAGCACGTGAGGGGTCTGAAGGG - Intergenic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1134856574 16:17524904-17524926 CATCCTGAGAGCTTTCTGAAAGG - Intergenic
1137817240 16:51410133-51410155 CAGTGGGTGAGGGGTCTGAAGGG - Intergenic
1138312885 16:56043114-56043136 CAGCCTGGGAGCGGTCAGGAGGG - Intergenic
1141073299 16:80978276-80978298 CAGGTTGAGAAGGGTCTTAAGGG + Intronic
1146816051 17:35943488-35943510 GACCCTGAGAGGGGGCTTAATGG - Intronic
1148090439 17:45019845-45019867 CAACCTTGGAGGGGTCTGAAGGG + Intergenic
1148723053 17:49768663-49768685 CAGCCTGAGAGGGATTGGGAAGG + Intronic
1148781150 17:50122844-50122866 CAGCCTGCGAGGGGAAGGAAGGG + Intronic
1151466718 17:74290344-74290366 CAGACTGAGAAGGGACTCAAGGG + Intronic
1151521715 17:74635049-74635071 AAGCATGAGAAGGGACTGAAAGG + Intergenic
1152147230 17:78575674-78575696 CAGCTTGTGAGGGGTCTGTCAGG - Intronic
1152661740 17:81545567-81545589 CTGCCTGAGTGGGGTCTGCTTGG + Intronic
1153540250 18:6146260-6146282 CTGCCTGTGTGGGCTCTGAAGGG - Intronic
1153586129 18:6622504-6622526 CAGGCTGAGACAGGACTGAATGG - Intergenic
1155936986 18:31764330-31764352 CAGCCTGAGAAGGGTGACAATGG - Intergenic
1156487554 18:37476238-37476260 CAGGCTGACAGTGTTCTGAAGGG + Intronic
1157373588 18:47141678-47141700 CAACCTGAGAGAGCTCTCAATGG - Intronic
1157577098 18:48750682-48750704 GAGCCTGGGAGGGCTCTGGATGG - Intronic
1159060807 18:63512113-63512135 CAGTCTGAGCTGAGTCTGAAAGG + Intergenic
1160356410 18:78230984-78231006 CAGGATGAGCTGGGTCTGAATGG - Intergenic
1160739399 19:679093-679115 AAGCCAGAGGGGGGTCTGGAGGG - Intronic
1160823317 19:1068091-1068113 GAGCCTGAGGGGGGCTTGAAGGG + Intronic
1161692734 19:5746369-5746391 CAGCCTCAGAGTTGTCTGACTGG - Intronic
1165728135 19:38126396-38126418 CAGCCCAAGAGGGCTTTGAATGG + Intronic
1168298553 19:55389913-55389935 CAGCCAGAGATGGGCCTGAGTGG - Intronic
925291526 2:2751468-2751490 CTGAGTGAGAGGGGTCTGGAGGG - Intergenic
925292951 2:2760698-2760720 CAGCCTGAGTGGGCTTGGAAGGG - Intergenic
925468902 2:4137742-4137764 CAGGGTCAGAGGGGCCTGAATGG - Intergenic
926476670 2:13330516-13330538 CAGCTTGAGAGGGGCGTAAAGGG + Intergenic
926701250 2:15805267-15805289 CAGCCTGAGTGGGAACTAAAAGG + Intergenic
926817366 2:16813319-16813341 CAGCTTGAAATGAGTCTGAAAGG + Intergenic
927111308 2:19865343-19865365 CAGCCTGAGATGAGCCTGCAGGG + Intergenic
927639112 2:24835590-24835612 CGGGCTGAGAGCTGTCTGAACGG + Intronic
928278428 2:29922266-29922288 GCGACTGACAGGGGTCTGAAAGG - Intergenic
929995183 2:46821564-46821586 CAGAGTGAGAGGGGTCTCATGGG + Intronic
930338802 2:50084589-50084611 CAGCCTGCGGGGGGTGTGGAGGG - Intronic
930760466 2:55029461-55029483 CAGCCTGAGAGATGACTGGAAGG + Intronic
933165472 2:79070241-79070263 CAGCCAGAGAGGGAGCTGAAAGG - Intergenic
933592738 2:84250764-84250786 CTACCTGAGAGGCATCTGAATGG + Intergenic
934994631 2:98946039-98946061 AAGCCTGATAGGGGTCTCACTGG - Intergenic
935257789 2:101327776-101327798 TGGCCTGAAAGGGATCTGAAAGG + Intergenic
937297738 2:120819919-120819941 CAGCCTGAGCTGGGTCTTGAGGG + Intronic
939018533 2:136930893-136930915 CAGCCTGAGACAGGACTAAAGGG - Intronic
939575826 2:143893472-143893494 AAGCCTGACAGGGGTGAGAAGGG - Intergenic
941907360 2:170729771-170729793 CAGCCTAAGAGGGGCTTAAATGG - Intergenic
945028535 2:205642443-205642465 CATCCTGAGAGGGGGCTGTCTGG - Intergenic
948721905 2:239905865-239905887 CAGCCTGGGAGGGGACAGGAGGG + Intronic
1173013566 20:39204664-39204686 AAGCCTGAGATGGGTCTTAGGGG + Intergenic
1173338891 20:42136585-42136607 CAACCTTTGAGGGGACTGAAGGG + Intronic
1174545137 20:51319509-51319531 CCGCCTGAGAGTGGTCTGTGGGG - Intergenic
1175221684 20:57420940-57420962 CAGGCTGAGCTGGGGCTGAAGGG + Intergenic
1175604490 20:60301396-60301418 AAGCCTATGAGGTGTCTGAAAGG + Intergenic
1176112580 20:63417332-63417354 CTGCCTGAGCGGGGTCAGGAGGG - Intronic
1178259165 21:31083007-31083029 TAGCCTGAGAGGGGACTGTTGGG - Intergenic
1179457621 21:41509805-41509827 CAGCCTGGGATGGGACTGAATGG - Intronic
1180790653 22:18573886-18573908 CTGCCTGAGAGGGGTGTGGCGGG - Intergenic
1181231084 22:21421428-21421450 CTGCCTGAGAGGGGTGTGGCGGG + Intronic
1181247564 22:21513440-21513462 CTGCCTGAGAGGGGTATGGCGGG - Intergenic
1181556808 22:23675915-23675937 CAGCCTGACAGGAGGCTCAAGGG + Intergenic
1183746967 22:39697700-39697722 CAGCCAGAGAGGGGATTTAAAGG - Intergenic
1184563679 22:45278374-45278396 CTACGTGAGAGGGGCCTGAAAGG + Intergenic
1184615731 22:45637056-45637078 CATCCTGAAAGGGGTTGGAAAGG - Intergenic
1185348945 22:50324158-50324180 CAGCTTGAGAGGGGCCAGCAGGG - Intronic
949952573 3:9241425-9241447 CAGACTGGGAGGGGCCTGGAAGG + Intronic
950446199 3:13040277-13040299 CAGCCTGAGGGAGGTCTTATTGG - Intronic
953071394 3:39524081-39524103 GAGGGTGAGAGGTGTCTGAAGGG - Intronic
954536432 3:51362486-51362508 CAGCAGGATAGAGGTCTGAATGG - Intronic
954796178 3:53162163-53162185 CACCCTGGGAGGGGTCTCAGAGG - Intronic
955958908 3:64319026-64319048 CAACCTGAGAGTGGCCTGTAGGG - Intronic
959574481 3:107919532-107919554 CAACCTGAGTGGGGGCCGAAGGG + Intergenic
962264818 3:133937345-133937367 CAGCAGGAGCAGGGTCTGAAGGG + Intronic
962307238 3:134299729-134299751 CAGTCTGAAAGGAGACTGAAAGG - Intergenic
964729436 3:159849627-159849649 CAGAGTGAGTGGGGTCTGCAGGG + Intronic
965633935 3:170761620-170761642 CAGTCTGAAAGGGGTCTGGTAGG + Intronic
965821927 3:172692980-172693002 CTGGCTGAGCTGGGTCTGAATGG - Intronic
967070094 3:185955495-185955517 CAGACAGAGGGGCGTCTGAAAGG + Intergenic
969615827 4:8252144-8252166 CAGCCTGGGAGGGGCAGGAAGGG - Intergenic
969631812 4:8343362-8343384 CAGCCTCAGGGGGTTCTGGAAGG + Intergenic
980183469 4:129432008-129432030 CAGCATGAGAGTGAACTGAATGG + Intergenic
981054852 4:140350135-140350157 TTGCCTGAATGGGGTCTGAAAGG - Intronic
981084886 4:140673424-140673446 CAGCCTGACTCGGTTCTGAAAGG + Intronic
982028659 4:151277335-151277357 CAGCCTGAGAAGGTCCTGAGAGG + Intronic
985667702 5:1190547-1190569 GAGCCTGGGAAGGCTCTGAAGGG - Intergenic
986661516 5:10064347-10064369 GTGGCTGCGAGGGGTCTGAAGGG - Intergenic
986709118 5:10475062-10475084 CCACCTGAGAGGCTTCTGAAGGG - Intergenic
987167351 5:15214587-15214609 CAGCCTGGGAGATGGCTGAAAGG + Intergenic
991920013 5:71647381-71647403 CAGCCTAAGAGGGTCCTGCATGG + Intronic
992409748 5:76493491-76493513 CAGGGTCAGAGGGGTCAGAAGGG - Intronic
992873496 5:81029060-81029082 CAGCCTGAGATTGGACTGCAAGG + Intronic
994658727 5:102627331-102627353 CAGCCTGAGCTGGGGCTGAGTGG - Intergenic
997469167 5:134107228-134107250 CAGCCTCAGAGGGGCCAGGAGGG + Intergenic
999467647 5:151822660-151822682 CAACCAGTGAAGGGTCTGAAAGG - Exonic
1000880733 5:166693953-166693975 AAGCCTGAAAGGGCTGTGAAGGG - Intergenic
1002456225 5:179346449-179346471 CAGCCTGAGAGGGGGCTCTCAGG - Intergenic
1002633952 5:180598063-180598085 CAGTCTGAGATGGGTCTGCACGG + Intergenic
1004286047 6:14322032-14322054 CAGTTTGAGATGGCTCTGAAGGG - Intergenic
1004425250 6:15502667-15502689 CAGCCTGAGGCGGGTCTGCAGGG - Intronic
1005744987 6:28828301-28828323 CAGCTTGAAAGGGATCTCAATGG + Intergenic
1006134349 6:31886894-31886916 CAGCCTGTGAGGGGGCAGGAGGG + Exonic
1006150193 6:31982953-31982975 CATCCTGAGAGGGCTCGGAGGGG - Intronic
1006156494 6:32015691-32015713 CATCCTGAGAGGGCTCGGAGGGG - Intronic
1006920853 6:37626185-37626207 CAGCCTGAGGAGGGCCTGCAGGG - Intergenic
1007482714 6:42160649-42160671 CATCCTGAGAGGGGTCCAGAAGG + Intronic
1010286589 6:74084774-74084796 CAGTCTGAGATGGAACTGAAAGG - Intergenic
1014357690 6:120432984-120433006 CAGTCTGAGATGGATCTGCAGGG + Intergenic
1015702411 6:136050922-136050944 CAGCCTGGGAAGCGTCTGAGAGG - Intronic
1016364084 6:143297128-143297150 CAGACTTAGAGAGTTCTGAAAGG + Intronic
1019368159 7:645855-645877 GAGCCCCAGAGGGGTCTGACTGG - Intronic
1020212707 7:6167843-6167865 CCGCCTGGGAGGGGTCTGCCAGG + Intronic
1022374298 7:29799264-29799286 AAGCCTTAGAGGGGTGTGAGAGG - Intergenic
1024548461 7:50541094-50541116 CAGCCTGAGAGGGGTCTGAATGG - Intronic
1025191425 7:56898646-56898668 CAGCCTGAGAGGGGGTTGGATGG - Intergenic
1025680523 7:63678288-63678310 CAGCCTGAGAGGGGGTTGGATGG + Intergenic
1028123490 7:87084591-87084613 CATCCTGAGAGAGGACGGAAAGG - Intergenic
1029426049 7:100494471-100494493 CAGCCAAGGAGGGGTCTGCATGG + Exonic
1029590606 7:101504422-101504444 CAACATGAGAGGGGTCAGCATGG - Intronic
1030217861 7:107064658-107064680 CAGCCTGTGAAGGGGCTCAAAGG - Intronic
1031508514 7:122618678-122618700 CAGCCTAAGAAGACTCTGAAAGG - Intronic
1032202047 7:129829052-129829074 CAGCCTGCCAGGGGGCTGCAAGG + Intergenic
1035587180 8:785604-785626 CGGTCTCAGAGGGGTCTGAGGGG - Intergenic
1039027588 8:33274708-33274730 CAGCCTGAGAGGCGGATTAAAGG + Intergenic
1039059374 8:33561387-33561409 CAGCCTGAAAGAGGTTTGAATGG - Intronic
1043387727 8:79765241-79765263 CAGCCTGCGTGGGTGCTGAAGGG + Exonic
1044592840 8:93930747-93930769 CAGCCAGAGAAGGGATTGAAGGG - Intergenic
1044859941 8:96513402-96513424 CAGCCTGTGAAGGCTCAGAAGGG - Intronic
1045248240 8:100461720-100461742 CAGGCTGAGAGTGGTCTTGAGGG - Intergenic
1046040723 8:108900567-108900589 AAGCCTGAGAGAGGTAAGAAAGG + Intergenic
1046612152 8:116437823-116437845 AAGTCTGAGAGGGGTCTCAATGG - Intergenic
1048787590 8:138066884-138066906 CAGTCTGAGAGAGGACAGAACGG - Intergenic
1049464020 8:142742960-142742982 CAGCCTGAGAGTGGTCTAGCTGG - Intergenic
1049586442 8:143434687-143434709 CTGCCTGGGAGGGGCCTGGAAGG + Intergenic
1050132346 9:2426093-2426115 GAGTCTGAGGGGGATCTGAAGGG - Intergenic
1050530049 9:6580789-6580811 CAGCCTGAGTGGGTCCTGAATGG - Intronic
1050895978 9:10886384-10886406 CAGCCTGGGAGAGGTCAGATGGG - Intergenic
1058653103 9:107195526-107195548 CAGGCTGAGATGGGGGTGAAAGG + Intergenic
1059261212 9:112978589-112978611 TAGTCTGACAGGGGGCTGAAGGG - Intergenic
1060813619 9:126623691-126623713 CAGCCTGGGAGGGGTGGGGAGGG + Intronic
1062427036 9:136510849-136510871 CAGCCTGGGAAGGGCCTGGAGGG - Intronic
1186484807 X:9925886-9925908 CAGCCGGTGAGGGGTATAAAAGG - Intronic
1190007475 X:46754574-46754596 CAGCCTGAGAGTGGGCTCATAGG - Intronic
1193993041 X:88332631-88332653 GAGCCTGAGAGGGGTAAGAAAGG + Intergenic
1195485068 X:105395287-105395309 CAGCCTCAGAGGGGGCAGACTGG - Intronic
1197171056 X:123434777-123434799 CAGCCTGAGACTTGCCTGAAAGG - Intronic
1199595220 X:149501683-149501705 AGGCCTGTGAGGGATCTGAAGGG + Intronic
1200010209 X:153114729-153114751 CAGCCTAAGTGGCTTCTGAAGGG - Intergenic
1200029391 X:153285193-153285215 CAGCCTAAGTGGCTTCTGAAGGG + Intergenic
1200612116 Y:5337666-5337688 CAGCAGGAGAGGGGAGTGAAGGG - Intronic