ID: 1024549164

View in Genome Browser
Species Human (GRCh38)
Location 7:50546425-50546447
Sequence GGGTAAGTATCAAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024549155_1024549164 7 Left 1024549155 7:50546395-50546417 CCCTGGGTGGAAAATTACTAAGA 0: 1
1: 4
2: 8
3: 23
4: 182
Right 1024549164 7:50546425-50546447 GGGTAAGTATCAAGGGTGGAGGG No data
1024549151_1024549164 28 Left 1024549151 7:50546374-50546396 CCAACGGTCAGGTGAGAGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1024549164 7:50546425-50546447 GGGTAAGTATCAAGGGTGGAGGG No data
1024549156_1024549164 6 Left 1024549156 7:50546396-50546418 CCTGGGTGGAAAATTACTAAGAG 0: 1
1: 0
2: 4
3: 20
4: 264
Right 1024549164 7:50546425-50546447 GGGTAAGTATCAAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024549164 Original CRISPR GGGTAAGTATCAAGGGTGGA GGG Intronic
No off target data available for this crispr