ID: 1024550467

View in Genome Browser
Species Human (GRCh38)
Location 7:50558810-50558832
Sequence CTCACTGGGGATGGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 799
Summary {0: 1, 1: 0, 2: 10, 3: 95, 4: 693}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024550453_1024550467 22 Left 1024550453 7:50558765-50558787 CCTCACCATGGCCAGAGATGAGA 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG 0: 1
1: 0
2: 10
3: 95
4: 693
1024550454_1024550467 17 Left 1024550454 7:50558770-50558792 CCATGGCCAGAGATGAGACCACA 0: 1
1: 0
2: 1
3: 22
4: 258
Right 1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG 0: 1
1: 0
2: 10
3: 95
4: 693
1024550456_1024550467 11 Left 1024550456 7:50558776-50558798 CCAGAGATGAGACCACAGGACTC 0: 1
1: 0
2: 3
3: 30
4: 401
Right 1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG 0: 1
1: 0
2: 10
3: 95
4: 693
1024550452_1024550467 29 Left 1024550452 7:50558758-50558780 CCTGTGTCCTCACCATGGCCAGA 0: 1
1: 0
2: 6
3: 27
4: 308
Right 1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG 0: 1
1: 0
2: 10
3: 95
4: 693
1024550459_1024550467 -1 Left 1024550459 7:50558788-50558810 CCACAGGACTCTAAACAGGGCTC 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG 0: 1
1: 0
2: 10
3: 95
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024550467 Original CRISPR CTCACTGGGGATGGGGAAGG TGG Intronic
900422579 1:2561999-2562021 CTCCCTGGGGGAAGGGAAGGTGG + Intronic
900687621 1:3958674-3958696 CACCCTGGGGCTGGGGAGGGAGG - Intergenic
900786672 1:4654363-4654385 GCGACCGGGGATGGGGAAGGGGG + Intergenic
900796890 1:4713320-4713342 CTCCCTGGGGATGTGTCAGGAGG + Intronic
901238176 1:7678636-7678658 TACACTGGGGATGCGGTAGGAGG + Intronic
903138216 1:21322888-21322910 CTCACTGGGGCTTTGGAGGGAGG + Intronic
903280581 1:22247835-22247857 GTGTCTGGGGCTGGGGAAGGGGG - Intergenic
903535942 1:24066470-24066492 ATAACTGGGGAAGGGGAGGGTGG - Intronic
903827154 1:26154866-26154888 CTCACGGAGGAGGGGGCAGGGGG - Intergenic
903839081 1:26225494-26225516 CTCACTTGGGGCGGGGAGGGAGG + Intergenic
903929633 1:26854912-26854934 CTCAAAGGGGATGGGGCAGGGGG - Exonic
903951835 1:27000173-27000195 TTGGCTGGGGATGGGGTAGGGGG - Exonic
904404364 1:30276251-30276273 CTCACTGACAATGGGGAAGGTGG - Intergenic
904676021 1:32199717-32199739 CTGCCCGGGGATGGGGAAGGTGG + Intergenic
904931666 1:34092587-34092609 CTCACTCGGGACGTGCAAGGGGG + Intronic
904941195 1:34165823-34165845 CTCTCCTGGGATGGGGTAGGAGG - Intronic
905013108 1:34760224-34760246 GGGATTGGGGATGGGGAAGGAGG + Intronic
905145818 1:35886096-35886118 CTCCTTGGGGATGGGGGAGGGGG + Intronic
905244502 1:36603194-36603216 CCCATGGGGGATGGGCAAGGCGG + Intergenic
905322856 1:37130175-37130197 CTGCCTGGGGTGGGGGAAGGGGG - Intergenic
905462906 1:38133227-38133249 GGAACTGGGGATGGGGAAGAAGG + Intergenic
906048409 1:42850995-42851017 CTGCCTGAGGAAGGGGAAGGGGG + Exonic
906197857 1:43940154-43940176 AGCACTGGGGATAGGGAAAGGGG - Intergenic
906677454 1:47703312-47703334 CTCTCTGTGGAGGGGCAAGGAGG - Intergenic
907246690 1:53113582-53113604 GGCCCTGGGGATGGGGAAGGGGG - Intronic
908354986 1:63320132-63320154 CTCCCTGGGGAAGGGGGTGGAGG - Intergenic
911830864 1:102550165-102550187 ATCACAGGGGAAGGTGAAGGAGG + Intergenic
912075098 1:105864057-105864079 ATCACAGGGGAAGGGGAAGCAGG - Intergenic
912513000 1:110201225-110201247 CACAGTGGGGAGGGGGCAGGCGG - Exonic
912652013 1:111448642-111448664 CTCACTTGGGTTGGGGAGAGAGG - Exonic
912669426 1:111610591-111610613 GTCACTGAAGATGGGGAAGATGG + Intronic
913044322 1:115060962-115060984 CGGCCTGGGCATGGGGAAGGGGG + Intronic
913200533 1:116492565-116492587 CTCACTAGGAATGGGGGGGGGGG - Intergenic
913301274 1:117371907-117371929 CTCCCTTGGGAGGGGGACGGGGG + Intronic
913975544 1:143451744-143451766 CTCTCTGGGGGTGGGGGGGGTGG - Intergenic
914048613 1:144113269-144113291 CACACTGGGGCCGGGCAAGGTGG + Intergenic
914130571 1:144852179-144852201 CACACTGGGGCCGGGCAAGGTGG - Intergenic
914473406 1:148003528-148003550 CTCTCTGGGGCGGGGGTAGGGGG - Intergenic
914835698 1:151205109-151205131 CAAACTGGGGAGAGGGAAGGTGG + Intronic
914859020 1:151371608-151371630 ATGACAGGGGGTGGGGAAGGAGG + Intronic
914899042 1:151702334-151702356 CACACTGGGAAGGGGGAGGGAGG - Intergenic
915168375 1:153961421-153961443 CACAATGGGGAGGGGGATGGAGG - Intronic
915168468 1:153962025-153962047 CACACAGGGAATGGGGAAGGGGG + Intronic
915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG + Intronic
915272629 1:154766080-154766102 ATGGCTGGGGAGGGGGAAGGTGG - Intronic
915301288 1:154953052-154953074 CCCACTGAGGAGGGAGAAGGGGG - Intronic
915310490 1:155003840-155003862 CTTACTTGGGATGGGGTGGGAGG - Intronic
915489967 1:156245495-156245517 TCCAGTGGGGACGGGGAAGGCGG - Intronic
916172191 1:162009751-162009773 CTGACTGGGGGTGGCCAAGGAGG - Intronic
917380537 1:174401412-174401434 CTCACCCGTGATGGGGAATGAGG + Intronic
917474031 1:175352936-175352958 CTCTCTGGGGATGGAGGAAGAGG + Intronic
917529837 1:175824787-175824809 CTCACTGGGACTGGGGATGAAGG + Intergenic
917794036 1:178520183-178520205 CTCATTGGGGAAGGGGGATGAGG + Intronic
919325494 1:196101396-196101418 CTCTCTGGGGAAGGGCAACGAGG - Intergenic
919730534 1:200911384-200911406 CACACTGGGGTTGGGGCGGGAGG - Intronic
920185471 1:204156611-204156633 GTCACTGGGGTTGGGGAGGGTGG - Intronic
920508682 1:206534921-206534943 CTCAGTTTGGATGAGGAAGGAGG - Intronic
920682553 1:208083908-208083930 CTGAATGGGGATGTGGAATGGGG + Intronic
921045998 1:211478617-211478639 CTCATTGGGGATGGGGGTAGGGG + Exonic
921165346 1:212503063-212503085 CTCAGTGGACATGGGGCAGGAGG - Intergenic
921681985 1:218044580-218044602 CTCACCCTGGATGGCGAAGGAGG - Intergenic
922135791 1:222825131-222825153 CTCCCCAGGGATGGGGAATGTGG + Intergenic
922534577 1:226370443-226370465 CTCACTGAGGATGGAGTATGCGG + Exonic
922683863 1:227624458-227624480 TTCAGTGGGGATGAGGAAGGAGG - Intronic
922767495 1:228163472-228163494 CTCACAGGGCTTGGGGCAGGTGG + Intergenic
922915324 1:229252745-229252767 CTTGCGGGGGATGGGGAGGGAGG - Intergenic
923496694 1:234531619-234531641 CTGACTGGGGATCGAGAGGGTGG + Intergenic
924024697 1:239819978-239820000 CTCACTGGGCAGTGAGAAGGTGG + Intronic
924452517 1:244190938-244190960 CTCACGGGGGGTGGGGGGGGGGG + Intergenic
924511994 1:244735434-244735456 CTCAGTGGGGATGAGGTAGGGGG - Intergenic
924803942 1:247347915-247347937 CTTACTGGGGATGGGGAGGTGGG - Intergenic
924916564 1:248575484-248575506 TTCACTGGGGACTGGGAAGAGGG - Intergenic
1062931343 10:1354654-1354676 CATCCTTGGGATGGGGAAGGTGG + Intronic
1063135485 10:3213146-3213168 CTCAGTGGGGTGGGGGGAGGGGG - Intergenic
1064176665 10:13081001-13081023 CTAAGTAGGGATGGGGCAGGAGG + Intronic
1064243418 10:13650620-13650642 GGCACTGGGGCTGGGGGAGGGGG + Intronic
1064402809 10:15035428-15035450 CTCATGGGGGAAGGGGAAGTAGG + Intronic
1064803893 10:19109197-19109219 CCCACTGGGGGTGGGGATGCTGG + Intronic
1065146338 10:22772004-22772026 CTGTCGGGGGATGGGGAGGGGGG + Intergenic
1065152944 10:22840746-22840768 GTCACTGGGGATGTGGTAGGAGG + Intergenic
1065537871 10:26732263-26732285 CTGACCTGGGATGGGGAAGCAGG + Intronic
1065836378 10:29661949-29661971 CTCACTGGGGCCGGGCATGGTGG - Intronic
1067112185 10:43408640-43408662 CCCCCTGGGGGTGGGGACGGGGG - Intronic
1067273228 10:44810586-44810608 CTCATTGTGGAAGGTGAAGGGGG - Intergenic
1068882189 10:62061856-62061878 TTCACTGGGGCTGGGGAATATGG + Intronic
1069283451 10:66684134-66684156 CTCAGTTGGGGAGGGGAAGGAGG + Intronic
1069535518 10:69250033-69250055 CTCACTGGCGATAGTGTAGGTGG + Intronic
1069551375 10:69366808-69366830 CTCACAAGGGAAGGGGAAGGGGG - Intronic
1069598969 10:69691051-69691073 CTCACTGTGGAAGGTGAAGTGGG - Exonic
1069633763 10:69913262-69913284 CTTACTTGGGCTGGGGAAGTGGG - Intronic
1069774692 10:70919583-70919605 CTCCCTGGGGAAGGGCAGGGAGG - Intergenic
1070199839 10:74193403-74193425 CACACTGGGGTGGGGGGAGGCGG - Intronic
1070370593 10:75778412-75778434 CTCACAGAGCAGGGGGAAGGTGG - Intronic
1070402824 10:76068414-76068436 CAGACTGGGGGTGGGGATGGGGG + Intronic
1070596059 10:77834069-77834091 CTCAAGAGGCATGGGGAAGGGGG + Intronic
1070752876 10:78974183-78974205 ATCTCTGGGGAGGGGGCAGGGGG - Intergenic
1070755818 10:78992657-78992679 CTCACAGGGGAGGGGGAGGTAGG + Intergenic
1070908276 10:80094037-80094059 CTCAGGGGTGATGGGGGAGGTGG - Intergenic
1071948705 10:90678203-90678225 CTCTGTGGGGAAGGGGAGGGTGG - Intergenic
1072631878 10:97151924-97151946 TGCAGTGGGGTTGGGGAAGGGGG + Intronic
1072766303 10:98097571-98097593 CTGACAGGGGATGGGGAAGCAGG - Intergenic
1073037557 10:100574849-100574871 CTCGCCGGGCATGGGGTAGGGGG - Intergenic
1073250065 10:102115594-102115616 TTCAGTGGTGGTGGGGAAGGGGG - Intronic
1073295920 10:102438622-102438644 CTCACTGGGGCTGGGGCTAGGGG + Intergenic
1075070227 10:119315418-119315440 CTCTCTGGGGGTGGCAAAGGTGG + Intronic
1075075248 10:119346204-119346226 ATCAGTGAGGAAGGGGAAGGAGG + Intronic
1075439526 10:122468500-122468522 CTCCCTGGGGATGAGGTGGGTGG + Intronic
1075626143 10:123965742-123965764 CTGTCTGTAGATGGGGAAGGAGG + Intergenic
1075937105 10:126351772-126351794 CTCACTGGGGGTGGGGGTGCAGG - Intronic
1076048166 10:127311760-127311782 CTCACTGAGGATGAGGCAAGAGG - Intronic
1076298322 10:129404454-129404476 CTCCGTGGGGAGGGGGAAGGGGG + Intergenic
1076853196 10:133103064-133103086 GTCACTGGGGGTGGGGCAGAGGG + Intronic
1077082134 11:728921-728943 CTAAATGGGGCTGGGGGAGGTGG - Intergenic
1077151839 11:1076296-1076318 ATAGCTGGGGATGGGGAAGGGGG - Intergenic
1077282656 11:1752695-1752717 CCAACTTGGGATGGGGAAGGAGG - Intronic
1077312601 11:1897200-1897222 TTCACAGTGGATGGAGAAGGCGG + Intergenic
1077703500 11:4462665-4462687 GGCAATTGGGATGGGGAAGGTGG - Intergenic
1077874298 11:6291016-6291038 CCCACTGGTGTTGGGGAAGAAGG + Intergenic
1078459115 11:11499829-11499851 CTCACAGGTGATGGGTAATGTGG + Intronic
1078581158 11:12540647-12540669 ATGATTGGGGATGGGGCAGGAGG + Intergenic
1079334792 11:19561897-19561919 ATCCCTGGGGATGATGAAGGGGG + Intronic
1079678184 11:23259550-23259572 ATCACTGGGAATGGGGAAGCTGG - Intergenic
1080108678 11:28540880-28540902 CTCAGTGGGGATGGGGCTGGGGG - Intergenic
1080368941 11:31611509-31611531 CTCATTGAGGTTGGGGAAAGGGG + Intronic
1080735574 11:35010626-35010648 CTCTCTGGGGCTGGGCATGGTGG + Intronic
1081553517 11:44136230-44136252 TACACTGGGGGTGGGAAAGGAGG - Intronic
1082088363 11:48068493-48068515 ATCACGGTGGAAGGGGAAGGAGG - Intronic
1082862554 11:57869798-57869820 CTCATGGAGGAAGGGGAAGGGGG + Intergenic
1083297947 11:61725338-61725360 CCCACTGGGGATGGGGTTGGGGG + Intronic
1083307781 11:61769941-61769963 CTCAGAGGAGATGGGGACGGAGG + Intronic
1083389234 11:62335963-62335985 CTGGCTGAGGCTGGGGAAGGTGG - Intergenic
1083607734 11:63988782-63988804 CACCCTGGGGGTGGGGCAGGAGG + Intronic
1083638373 11:64132424-64132446 GTCACTGGGGGTGGGGCGGGGGG + Intronic
1083727549 11:64636389-64636411 CTCTCTGGGGGTGGGGGTGGGGG + Intronic
1083766834 11:64845265-64845287 CACACTGAGGCTTGGGAAGGAGG + Intergenic
1083768215 11:64852468-64852490 TTCACTTGGGGTGGGGAGGGGGG - Exonic
1083889086 11:65586966-65586988 CACAATGGGCATGGGGGAGGGGG - Intronic
1084113083 11:67025838-67025860 CTTACGGGTGATGGGGAAGACGG + Intronic
1084976986 11:72806585-72806607 CTCACTGTGGAAGGTGAAGGGGG + Intergenic
1085125301 11:73997699-73997721 CTCACTGGGGTGGAGGATGGTGG - Intergenic
1085256229 11:75175116-75175138 CACACTGGGGATGGGGAGTGGGG + Intronic
1085466630 11:76728470-76728492 CTCACTGGGCAGGGGGGAGCTGG + Intergenic
1085676563 11:78525675-78525697 CTCACTGGGGATGGGGGTTTGGG - Intronic
1086174946 11:83880108-83880130 CTGACTGTGGATGGGCAATGAGG + Intronic
1088209747 11:107442219-107442241 CTCACAGTAGAAGGGGAAGGGGG + Intronic
1088275932 11:108085408-108085430 TTACCAGGGGATGGGGAAGGGGG + Intronic
1088511852 11:110583804-110583826 CTCACTTTGAATGGGGAAGAGGG + Intronic
1088514016 11:110609142-110609164 ATCACTGGGTAGGGGGCAGGAGG - Intronic
1088779507 11:113120826-113120848 TTCATTGGGGAGAGGGAAGGAGG + Intronic
1088904314 11:114142837-114142859 CCCGATGGGGATGGGGGAGGAGG - Intronic
1088922504 11:114271376-114271398 ATCACTGGGGTTGGGGTGGGTGG - Intronic
1089104398 11:115990157-115990179 CTCGCTGGGCATGGGGAAGGCGG - Intergenic
1089329735 11:117680953-117680975 CTCAAAGAGCATGGGGAAGGGGG + Intronic
1089378697 11:118012680-118012702 CAGATTGGGGATGGGGCAGGGGG + Intergenic
1089493906 11:118899172-118899194 CCCACTGGGGGTGGGGGCGGGGG - Exonic
1089583962 11:119498262-119498284 ACCACTGGGGAGGGGGCAGGTGG + Intergenic
1089616245 11:119696491-119696513 CTCAGTGGGGGTGGGGCAGCTGG - Intronic
1089665747 11:120017526-120017548 CTGATTGAGGATGTGGAAGGAGG - Intergenic
1089752516 11:120661433-120661455 CACACTGGGGGTGGGGTTGGGGG + Intronic
1090125952 11:124084303-124084325 GGGGCTGGGGATGGGGAAGGTGG + Intergenic
1090487800 11:127129623-127129645 CTCACTGGGAATTTGAAAGGAGG - Intergenic
1090677050 11:129008085-129008107 CTACCAGGGGATGGGGGAGGGGG + Intronic
1091275534 11:134346942-134346964 ATCACTGAGGCTGTGGAAGGAGG - Intronic
1091888264 12:4031962-4031984 CTCATGGGCGAAGGGGAAGGCGG + Intergenic
1092052412 12:5481023-5481045 CTCACTGGGGGTGTGGGTGGCGG + Intronic
1092116491 12:6012416-6012438 CACGCCAGGGATGGGGAAGGTGG + Intronic
1092796957 12:12121184-12121206 CTCTCTGTGTATGGAGAAGGTGG + Exonic
1092970897 12:13693741-13693763 GTCACCGGAGAAGGGGAAGGAGG - Intronic
1093518406 12:20018748-20018770 CACACTGGGGATGGGGACGGTGG + Intergenic
1094697577 12:32835768-32835790 CTTTCTGGGGCTGGGGGAGGGGG + Intronic
1095088964 12:38086557-38086579 CTCACAGGGTATTGGGGAGGAGG + Intergenic
1095304716 12:40625991-40626013 CTCATGGTGGAAGGGGAAGGGGG + Intergenic
1095512799 12:42971933-42971955 CTATTTGGGGTTGGGGAAGGAGG - Intergenic
1095800523 12:46267394-46267416 CTGCCTTGGGCTGGGGAAGGTGG - Exonic
1095981823 12:47978512-47978534 CTCACAGAGCATGGGGTAGGAGG - Intronic
1096148449 12:49294677-49294699 CTCTCTGGGTGTGGTGAAGGAGG + Exonic
1097023621 12:56037572-56037594 TTGACTGGGGAAGGGGATGGGGG - Exonic
1097177328 12:57150956-57150978 CTCCCTGGGGATGTGGATAGAGG + Intronic
1098825725 12:75294959-75294981 CTCACTGGGGAGAGGGAAATGGG + Intronic
1098929738 12:76397331-76397353 ATCACAGGGGGTGGGGAGGGGGG + Intronic
1099905548 12:88765525-88765547 TTAAGTGGGGGTGGGGAAGGGGG - Intergenic
1100919223 12:99463493-99463515 CTCACTTGGGAAGTGCAAGGGGG + Intronic
1100982177 12:100170532-100170554 CTGCCAGGGGATGGGGCAGGCGG + Intergenic
1101076055 12:101130847-101130869 GGCAATGGGGAAGGGGAAGGTGG - Intergenic
1101686681 12:107030767-107030789 CTGTGTGGGGGTGGGGAAGGGGG + Intronic
1102219147 12:111182656-111182678 ATCGTTGGGGATGGAGAAGGAGG + Intronic
1103020273 12:117528442-117528464 CCAAATGAGGATGGGGAAGGGGG - Intronic
1103325059 12:120115100-120115122 GTAACTGAGGTTGGGGAAGGAGG - Intronic
1103594821 12:122018217-122018239 CTGGCTGGGGCTGGGGAAGGAGG + Intergenic
1103637695 12:122321487-122321509 CTCACGGGGGCTGAGGCAGGTGG - Intronic
1103951644 12:124554690-124554712 CTCAGTGGGAACGTGGAAGGTGG - Intronic
1104287172 12:127433913-127433935 CTCACTGGGGGTGGGGACGTTGG - Intergenic
1105578819 13:21675223-21675245 CGCAGTGGGGGTGGGGAAGCAGG + Intronic
1107387540 13:39928301-39928323 CACACTGGTGGTGGGGATGGTGG + Intergenic
1107449230 13:40493426-40493448 CTCATTGGAAATGGGGAAGTTGG - Intergenic
1107868953 13:44729620-44729642 CTCAGTGGGGGTGAGGAAGTGGG + Intergenic
1107904109 13:45046542-45046564 TTCACTGGGCAGGGGGAGGGAGG - Intergenic
1108054129 13:46468964-46468986 CTTGCTGGGGAGGGGGAAAGAGG + Intergenic
1108181701 13:47846433-47846455 ATCCCTGGGGGTGGGGTAGGGGG - Intergenic
1109801869 13:67390580-67390602 CCCACTGGGGAAGGGGAAAGGGG - Intergenic
1111603853 13:90510907-90510929 CTTACTGGGGCTGGGGCTGGTGG - Intergenic
1111835621 13:93385263-93385285 ACCACTGGAGAAGGGGAAGGAGG + Intronic
1112199442 13:97260820-97260842 ATATCTGTGGATGGGGAAGGTGG - Intronic
1112370468 13:98788767-98788789 CTCACTGGGGAGGGGGAATGGGG - Intergenic
1112471073 13:99690108-99690130 TCCACTGGGGCTGGGGGAGGAGG - Intronic
1112502559 13:99954431-99954453 CTCACTGGGGATGGGGGAACAGG + Intergenic
1113067831 13:106389870-106389892 CTTTCTGGGGAAGGGGAAGGAGG + Intergenic
1113218487 13:108070688-108070710 GTCACTGGAGGTGGGCAAGGTGG - Intergenic
1113264188 13:108598999-108599021 CACTCTGGGGATGGGGTGGGGGG - Intronic
1113398777 13:109973009-109973031 CTCACTGCGAATGGGGAATAGGG - Intergenic
1113745399 13:112741243-112741265 CACACTGGGGGTGGAGAAGGTGG + Intronic
1113745423 13:112741320-112741342 CACACCAGGGATGGAGAAGGTGG + Intronic
1114533494 14:23409473-23409495 CTGCCTGGGGAGGGGGCAGGTGG - Intergenic
1114613253 14:24055522-24055544 CTCTGTGGGGATATGGAAGGGGG - Exonic
1114923583 14:27364371-27364393 TTCACAGGGGATGGGGAACAGGG - Intergenic
1115298071 14:31852835-31852857 TTCACGGGGGAAAGGGAAGGAGG - Intronic
1115562010 14:34591054-34591076 CTGCCTGGGGATAGGGCAGGAGG + Intronic
1117978190 14:61318978-61319000 CTCTCTGGGGACAGGCAAGGTGG - Intronic
1118346712 14:64946383-64946405 CACACTGGGGCTAGGGAAGTAGG - Exonic
1118920032 14:70141803-70141825 TTCCCTGGGGATGTGAAAGGAGG - Intronic
1119297989 14:73548699-73548721 CTCACTGGGGGAGGAGAAAGGGG + Intronic
1119302278 14:73580896-73580918 CTCACTGGGGGAGGAGAAAGGGG + Intergenic
1119908565 14:78328114-78328136 CACACAGGGGATGGGGTGGGTGG + Intronic
1120147733 14:80997825-80997847 CTACCTGGGGATTGGGAAGTAGG - Intronic
1120763465 14:88306670-88306692 AGCACTGGGGCTGGGGGAGGGGG + Intronic
1121325430 14:93016916-93016938 CACTCTGGAGATGGGGCAGGAGG + Intronic
1121409267 14:93737965-93737987 CTCACAGGGGATGCTGAGGGAGG + Intronic
1121433598 14:93904133-93904155 CTCCCTGGGGATGGGGACAATGG + Intergenic
1121694856 14:95904273-95904295 CTCACTGGGGATCTGGGAGAAGG + Intergenic
1121751750 14:96363412-96363434 CACACTGGGGCCGCGGAAGGCGG + Exonic
1122416023 14:101549859-101549881 CGCACTGGGGGTGGGGTGGGGGG - Intergenic
1122847086 14:104505984-104506006 CTGAGTGAGGCTGGGGAAGGAGG + Intronic
1122871401 14:104640656-104640678 CTCACTAGGGATGAGGAGGGTGG - Intergenic
1122903176 14:104790347-104790369 CTGGCTGGGGGTGGGGAGGGAGG - Intronic
1122968172 14:105141492-105141514 CTTCCTGGGAATGGGGAGGGGGG - Exonic
1122997499 14:105273297-105273319 CTCTGTGCGGTTGGGGAAGGCGG - Intronic
1123645294 15:22433501-22433523 CTCCCAGGGGACGGGGCAGGTGG + Intergenic
1123666562 15:22613142-22613164 CTCCCAGGGGATGGGGCAGGTGG + Intergenic
1123699220 15:22902310-22902332 CTCCCGGGGTGTGGGGAAGGAGG + Intronic
1123751146 15:23359220-23359242 CTCCCAGGGGACGGGGCAGGTGG - Intronic
1124127111 15:26945981-26946003 CTCAGTGATGGTGGGGAAGGCGG + Intronic
1124143410 15:27097654-27097676 CTCAGTGGGGACTGGGTAGGTGG - Intronic
1124283521 15:28383138-28383160 CTCCCAGGGGACGGGGCAGGTGG - Intronic
1124299177 15:28528475-28528497 CTCCCAGGGGACGGGGCAGGTGG + Intronic
1124320405 15:28707715-28707737 CTCCCAGGGGATGGGGCAGGTGG + Intronic
1124482109 15:30087695-30087717 CTCCCAGGGGATGGGGCAGGTGG - Intronic
1124488567 15:30139795-30139817 CTCCCAGGGGATGGGGCAGGTGG - Intronic
1124521479 15:30409508-30409530 CTCCCAGGGGATGGGGCAGGTGG + Intronic
1124537182 15:30556711-30556733 CTCCCAGGGGATGGGGCAGGTGG - Intronic
1124543653 15:30608767-30608789 CTCCCAGGGGATGGGGCAGGTGG - Intronic
1124590286 15:31047605-31047627 CTGGGTGGGGTTGGGGAAGGGGG - Intronic
1124645177 15:31433506-31433528 CACACAGGGACTGGGGAAGGGGG - Intronic
1124754961 15:32398527-32398549 CTCCCAGGGGATGGGGCAGGTGG + Intronic
1124761471 15:32450880-32450902 CTCCCAGGGGATGGGGCAGGTGG + Intronic
1124777161 15:32598188-32598210 CTCCCAGGGGATGGGGCAGGTGG - Intronic
1125397709 15:39268363-39268385 GTCACTGGGTGAGGGGAAGGGGG + Intergenic
1125978458 15:43977430-43977452 CTCACTGGGGGTGGTGCATGGGG + Intronic
1126016224 15:44353787-44353809 CTTATTGGGGAAGGGTAAGGGGG + Intronic
1126615432 15:50574050-50574072 CCCTCTGGGGGTGGGGGAGGGGG + Intronic
1127285228 15:57526868-57526890 CACGCTGGGCATTGGGAAGGGGG + Intronic
1127850153 15:62905009-62905031 GGCTTTGGGGATGGGGAAGGGGG - Intergenic
1128212641 15:65913286-65913308 CTAACTGGGAACTGGGAAGGAGG + Intronic
1128287950 15:66454074-66454096 CTCACAGAGGATGGGGAAAGAGG - Intronic
1128325259 15:66719902-66719924 GTCACTGGGGAGGGGGGTGGTGG + Intronic
1128382744 15:67125399-67125421 TTCACTGGGACTGGAGAAGGTGG - Intronic
1128744638 15:70104730-70104752 CTGAGTTGGGATGGGGAATGGGG + Intergenic
1129109502 15:73329332-73329354 GACACTGGAGACGGGGAAGGTGG + Intronic
1129121683 15:73401257-73401279 CTTCCTGGAGATAGGGAAGGGGG + Intergenic
1129203944 15:74024195-74024217 CTTACTGGGAAAGGGGAGGGAGG + Intronic
1129231113 15:74197662-74197684 CCCACTGGGGCTGGTGAAGGGGG - Intronic
1129822760 15:78616064-78616086 CTCATTGGGGCTGGGCATGGTGG + Intronic
1131156965 15:90081351-90081373 CTCAGTGGGGAGGGGCAAGCAGG + Exonic
1131580656 15:93639571-93639593 TTCACTGGGGCCGGGCAAGGTGG - Intergenic
1131832175 15:96360981-96361003 TTCACTGGGGATGGAGAAATAGG - Intergenic
1132227046 15:100150799-100150821 GACACTGGGGCTGGGGAAGTGGG - Intronic
1132366604 15:101262240-101262262 CTCCCTGAGGTTGGGGAATGGGG + Intergenic
1132643912 16:990126-990148 CTCACTGGCTCTGGGGCAGGTGG + Intergenic
1132682006 16:1146269-1146291 ATCACTGTGGAGTGGGAAGGAGG - Intergenic
1132852828 16:2032622-2032644 CTGGCTGGGGATAGGGGAGGTGG + Intronic
1133184541 16:4086107-4086129 CTGCTTGGGGGTGGGGAAGGTGG + Intronic
1133305085 16:4803569-4803591 CACACTGGGGGTGGGGGCGGGGG - Exonic
1133453566 16:5923294-5923316 GTGATTGGGGATGGGGATGGTGG + Intergenic
1134617345 16:15661761-15661783 ATCTCTGGTGATGGGGATGGTGG + Intronic
1136913393 16:34161623-34161645 CTCATTCGTGATGGGGATGGGGG + Intergenic
1137275682 16:46931912-46931934 TTCCCTGGGGCTGGGGAGGGTGG + Intergenic
1137491348 16:48935685-48935707 GGGACTGGGGATGGGGAATGAGG + Intergenic
1137665304 16:50246115-50246137 CTCACCGCGGGCGGGGAAGGAGG - Intronic
1137724207 16:50646109-50646131 CTAACGGGGGCGGGGGAAGGGGG + Intergenic
1138009183 16:53361984-53362006 GTCCCAGGGGATGGGGCAGGTGG + Intergenic
1139315804 16:66067546-66067568 CTCTCTGAAGATGGAGAAGGAGG - Intergenic
1139949369 16:70661699-70661721 CTCACAGGGGAGGGGGACGGCGG + Exonic
1140687983 16:77451934-77451956 CTCATGGTGGAAGGGGAAGGGGG - Intergenic
1141035457 16:80621960-80621982 CTCACTGGTGTTGGGGAGGCTGG - Intronic
1141494010 16:84394363-84394385 CAGACTGGGACTGGGGAAGGGGG - Intronic
1142119128 16:88377279-88377301 CTCACAGAGGGTGGGCAAGGTGG + Intergenic
1142323768 16:89401096-89401118 CCCTCTGGGGAGGGGGAGGGCGG - Intronic
1142477718 17:199445-199467 CTGTCTGGGGCTGGAGAAGGAGG + Intergenic
1142554574 17:765175-765197 CTCACTGGAGATGGGCATGAGGG + Intronic
1142826778 17:2517768-2517790 CTAACTTGGGGTGGGGAAGAGGG + Intergenic
1142848792 17:2694561-2694583 CTCACTGAGGAGGGAGCAGGGGG + Exonic
1143114891 17:4576799-4576821 CTAACTGGGGCTGGGGCTGGCGG - Intergenic
1143296636 17:5876267-5876289 GACACTGGGGATGGGGAGGAGGG + Intronic
1143307606 17:5959903-5959925 TTCACAGGGGATGGGGCAGGAGG + Intronic
1143408106 17:6691347-6691369 CTGACTGGGTATAAGGAAGGAGG - Intronic
1143467258 17:7145838-7145860 GACAGTGGGGGTGGGGAAGGGGG - Intergenic
1143476918 17:7208236-7208258 ATTTCTGGGGATGGGGACGGAGG + Exonic
1144792594 17:17869046-17869068 CTCCCTGGGGCTGGGGGTGGCGG + Intronic
1144909640 17:18670878-18670900 ATCACTGAGGAAGGGGAAGTGGG - Intronic
1144970782 17:19108217-19108239 GTCTCTGGGGTTAGGGAAGGAGG - Intergenic
1144991084 17:19234379-19234401 GTCTCTGGGGTTAGGGAAGGAGG - Intronic
1145784610 17:27585937-27585959 CTCGGTGGGGAAGGGCAAGGTGG - Intronic
1146176289 17:30668149-30668171 CTCTCTCCGGCTGGGGAAGGTGG + Intergenic
1146349744 17:32084259-32084281 CTCTCTCCGGCTGGGGAAGGTGG + Intergenic
1146376627 17:32298907-32298929 CCCACTGGGGAGGGGGCAGAAGG - Intronic
1146538827 17:33677013-33677035 CTCACAGTGGAAGGGGAAGCAGG - Intronic
1146543407 17:33717686-33717708 CTCACTGGGGCTTGGGCAGGGGG - Intronic
1146552382 17:33792401-33792423 CTCATTGGGGGTGGTGGAGGGGG + Intronic
1146886525 17:36474608-36474630 CTCTGTGGGCATGTGGAAGGAGG + Intergenic
1146929214 17:36765926-36765948 CTCCCTGGGGATGGGGTGGGAGG + Intergenic
1146972652 17:37085289-37085311 AGCTCTGGGGATGGGGGAGGAGG + Exonic
1147192984 17:38748127-38748149 CCCTCTGGGGATTGGGATGGGGG - Intronic
1147394508 17:40131379-40131401 CTCTCTGGGGGAGGGGAAGAGGG - Intronic
1147404623 17:40202009-40202031 CTGCCTGGGGATGAGGGAGGAGG + Intergenic
1147653766 17:42076908-42076930 CTCACTGGGCAAGTGGAAGGTGG - Intergenic
1148049252 17:44761019-44761041 GTCACTGGGGGTGGGGTGGGGGG + Intronic
1148052085 17:44774473-44774495 CGTACTGGGGGTGGGGAAGATGG - Exonic
1148835870 17:50465455-50465477 CTTGCTGGGGCTGGGGAAGAAGG + Intronic
1148854397 17:50570806-50570828 CTGAAGGGGGATGGGGTAGGAGG + Intronic
1149436130 17:56634953-56634975 ATATCTGGGGATGGGCAAGGTGG + Intergenic
1149598079 17:57875690-57875712 CAGACTGGGGGAGGGGAAGGAGG + Intronic
1149999442 17:61424465-61424487 CTCACTGGCCATGGGCAGGGAGG - Intergenic
1150604681 17:66680784-66680806 CACATTGGGGGTGGGGGAGGTGG + Intronic
1150781722 17:68128676-68128698 CACACTGAGGATGAGGAGGGAGG - Intergenic
1151194353 17:72421128-72421150 TCCACAGGGGTTGGGGAAGGGGG - Intergenic
1151384456 17:73746637-73746659 CTCCCCGGAGATGGGGGAGGCGG + Intergenic
1151698617 17:75730901-75730923 CTCACTGGGGGTGCTGCAGGAGG + Exonic
1151720601 17:75853714-75853736 CTGACTGGGGAAGGGTAAGTGGG + Intronic
1151799610 17:76370333-76370355 GTCAGTGGGGAAGGGGAAGGAGG - Intronic
1152456865 17:80421763-80421785 CGGACTGGGGATGGAGCAGGTGG + Intronic
1152628402 17:81398837-81398859 CCCGCTGGGGCTGGGGAGGGGGG + Intronic
1152676213 17:81642606-81642628 CGCAGTGGGGAAGGGGGAGGGGG - Intronic
1152724026 17:81936560-81936582 CTTCCTGGGAATGGGGAGGGAGG - Intronic
1153969736 18:10215405-10215427 CTAATTAGGTATGGGGAAGGAGG + Intergenic
1154293478 18:13130640-13130662 CCCAGTGGGGATGGGGCTGGGGG - Intergenic
1154501750 18:15000912-15000934 CCCACTGGGGGTGGGCAGGGCGG + Intergenic
1156369096 18:36456612-36456634 CTGGATGGGGCTGGGGAAGGAGG + Intronic
1157179199 18:45480682-45480704 CCCCCAGGGGAGGGGGAAGGTGG - Intronic
1157199921 18:45651340-45651362 CTCACAGGGGATGATGAAGCTGG + Intronic
1157293702 18:46427140-46427162 CACTCTGGGGATGGAGATGGTGG + Intronic
1157468831 18:47971899-47971921 CTGTCAGGGGATGGGGTAGGGGG - Intergenic
1157654191 18:49369267-49369289 CTCTCAGGCAATGGGGAAGGAGG - Intronic
1157700492 18:49759083-49759105 GGCACTGGGGGTGGGGGAGGAGG - Intergenic
1157911799 18:51623365-51623387 CTAACTGGGGGTGGAGAGGGTGG + Intergenic
1158169880 18:54585841-54585863 CTCACTGTGGATGGAGAATGGGG - Intergenic
1158311562 18:56165166-56165188 ATCACTGTGGAAGGTGAAGGAGG - Intergenic
1158721955 18:59933013-59933035 CCCACTGGGGATGGGGACTGGGG - Intergenic
1158735629 18:60075675-60075697 GGCACTGGAGATGGGGAGGGAGG - Intergenic
1159166146 18:64703273-64703295 CCAAATGGGGAGGGGGAAGGTGG - Intergenic
1159395169 18:67846734-67846756 GCCAGTGGGGAAGGGGAAGGGGG - Intergenic
1159424904 18:68272518-68272540 CACTCTTGGGAGGGGGAAGGGGG - Intergenic
1159478894 18:68960859-68960881 CTGCCAAGGGATGGGGAAGGTGG + Intronic
1160362521 18:78296113-78296135 CACACTGGCGACGGGGAAGATGG - Intergenic
1160500340 18:79398526-79398548 AGCACTGGGGCGGGGGAAGGGGG + Intronic
1160853360 19:1205465-1205487 CTCGGTGGGGCTCGGGAAGGGGG - Intronic
1160877672 19:1304803-1304825 CTCACTGGGGCTGGGGTCGGGGG - Intergenic
1160898411 19:1413966-1413988 TTCACTGGGGGTGGGGCAAGAGG - Intronic
1160940788 19:1619569-1619591 CTTCCTGGGGAAGGGGAAGATGG - Intronic
1160978997 19:1807861-1807883 CTCAGAGGCGAGGGGGAAGGAGG - Intronic
1161206930 19:3046437-3046459 CGGGCTGGGGATGGGGAAGGGGG + Intronic
1161221451 19:3119955-3119977 CTCTCTGGGCCTGGGGATGGCGG + Intronic
1161249913 19:3275149-3275171 CTCCCTGGTAATGGGGAACGTGG - Intronic
1161368887 19:3898110-3898132 GTCACTGGGGTTGGGGGAGAGGG - Intronic
1161755538 19:6130921-6130943 TACACTGGAAATGGGGAAGGGGG - Intronic
1162145762 19:8611314-8611336 CTGAGTGGGGTTGGGGGAGGTGG + Intergenic
1162205902 19:9055805-9055827 CTGGCTGGGGATGGGGAAGCCGG - Intergenic
1162475370 19:10896428-10896450 GGCAATGGGGATGGGGAAGAGGG - Intronic
1162844723 19:13383356-13383378 GTCAATGGAGATGGGGAAGATGG + Intronic
1162922731 19:13913047-13913069 CTCACTGGGGCAGGGGAGGCTGG + Intronic
1163384297 19:16989896-16989918 CTCCCTGAGGATTGGGGAGGGGG - Intronic
1163843851 19:19627966-19627988 CAGACTGGGGAAGGGGTAGGGGG + Exonic
1164244938 19:23420591-23420613 CTCACAGGGTATTGGCAAGGAGG + Intergenic
1164537665 19:29098458-29098480 CTCAGAGGGGAAGGTGAAGGGGG - Intergenic
1164883176 19:31753415-31753437 ATTGCTGGGGCTGGGGAAGGTGG + Intergenic
1165714614 19:38036372-38036394 GTCCCTGGGGACGGGGAAGGAGG - Intronic
1165782627 19:38442891-38442913 CACGCTTGGGATGGGGGAGGTGG - Intronic
1166117924 19:40667195-40667217 GTGTCTGGGGTTGGGGAAGGGGG + Exonic
1166288207 19:41845281-41845303 CTCCCTGGGGCACGGGAAGGGGG + Intronic
1166347371 19:42175153-42175175 CTCACTGGGGCTCTGGGAGGGGG - Intronic
1166759924 19:45218028-45218050 CTCCCTGTGGATGGGAGAGGTGG - Intronic
1167035849 19:46994582-46994604 CTCGCCGGGGATGAGGATGGTGG + Intronic
1167243892 19:48362413-48362435 CTCTCGGGGGCTGAGGAAGGAGG + Intronic
1167716392 19:51144975-51144997 CTCCCTGGGGCTGGGGGAGCAGG + Intronic
1167762226 19:51457146-51457168 CTCCCTGGGGTTGGGGGAGCAGG - Intronic
1168226011 19:54995752-54995774 TTGACTCGGGATGGGCAAGGTGG + Intronic
1168275265 19:55274393-55274415 CTCACAGGAGATGGCGAAGAGGG + Exonic
1168276170 19:55279886-55279908 CGCAGTGGAGATGGGGAAGGGGG - Intronic
1168315937 19:55484814-55484836 GTCCCTGGGGATGGGGGAGTCGG + Intergenic
1168520416 19:57045986-57046008 CTCCCAGGGGATGGGGATGCAGG - Intergenic
1168550089 19:57285495-57285517 CTCACTGACGATGGGGATGCTGG - Intronic
1168637013 19:58004129-58004151 CTCACTGTGGGTGGGCAAAGGGG + Intronic
1202688066 1_KI270712v1_random:66172-66194 CACACTGGGGCCGGGCAAGGTGG + Intergenic
925952441 2:8927699-8927721 AGAACTGGGGAAGGGGAAGGAGG + Intronic
926223084 2:10948932-10948954 CACACTGGGGCTGGGGTAGATGG + Intergenic
926610558 2:14942467-14942489 ATCACAGTGGAAGGGGAAGGGGG - Intergenic
926620134 2:15039991-15040013 CTCTCTGGAGACGGGGAAGATGG - Intergenic
927138076 2:20111847-20111869 CTCACTGGGGCTGTGGAGTGAGG + Intergenic
927145726 2:20164466-20164488 CTCAGTGCAGATGGGGAGGGAGG - Intergenic
927219153 2:20690688-20690710 CTGGCGGGGGATGGGGGAGGAGG + Intronic
927440567 2:23113523-23113545 GTCACTGGGGTTGGGGGAGAGGG - Intergenic
927641686 2:24849452-24849474 CTCTCTGGGGGTGGGACAGGGGG + Intronic
928275684 2:29898153-29898175 CTGCCTGGGGCTGGGGAAGGTGG - Intronic
929954617 2:46446764-46446786 CTCCCTGAGGATGGGGGATGGGG - Intronic
930476452 2:51888508-51888530 CACCCTGGGGGAGGGGAAGGGGG - Intergenic
930545158 2:52758295-52758317 CTCCATGGGGATGGTGAAGAGGG + Intergenic
930721399 2:54641677-54641699 CACACAGGGAATGGGGCAGGGGG - Intronic
931267154 2:60670693-60670715 TTCAGTGAGGATGGGGATGGGGG - Intergenic
931582883 2:63796495-63796517 CTGCCAGGGGATGGGGGAGGGGG - Intronic
931625070 2:64250062-64250084 CTCACTGGTGCTAGGGATGGGGG + Intergenic
932084561 2:68746704-68746726 CCCTGTGGGGATGGGGAGGGGGG - Intronic
933958288 2:87389422-87389444 CACACTGGGGCCGGGCAAGGTGG - Intergenic
934169298 2:89326066-89326088 CTCACAGAGGGTGGGGAAGATGG + Intergenic
934197996 2:89856518-89856540 CTCACAGAGGGTGGGGAAGATGG - Intergenic
934242414 2:90281339-90281361 CACACTGGGGCCGGGCAAGGTGG - Intergenic
934270760 2:91535344-91535366 CACACTGGGGCCGGGCAAGGTGG + Intergenic
934521785 2:95024559-95024581 CTCCCTAGGGACTGGGAAGGAGG + Intergenic
934539616 2:95162986-95163008 CTCACTGTGGAAGGTGAAGTGGG + Intronic
935065178 2:99641164-99641186 CTGACAGGGGAAGGAGAAGGGGG - Intronic
935315459 2:101829292-101829314 CCCACTGGGAATGTGGAGGGTGG + Intronic
936154582 2:110039827-110039849 GCCACTGGGGATGGGGCAGGGGG + Intergenic
936190101 2:110331587-110331609 GCCACTGGGGATGGGGCAGGGGG - Intergenic
937223698 2:120356408-120356430 CCCTATGGGGATGGGGTAGGAGG - Intergenic
937284388 2:120741064-120741086 CTCAGTGGGCTTGGGGGAGGTGG + Intronic
937322375 2:120968660-120968682 ATCACTGGGGATGGGGGAGGGGG - Intronic
937859887 2:126699265-126699287 CTGACTAGGGATGGGGATGCTGG - Intergenic
938500930 2:131831079-131831101 CCCACTGGGGGTGGGCAAGGCGG + Intergenic
938765695 2:134459514-134459536 TTCACTGGGGATGGGAAGGTGGG - Intronic
939069240 2:137518945-137518967 CTCACTGGAAAAGGGGAAAGGGG + Intronic
939542605 2:143512361-143512383 GTCACTGGAGATGGAGAGGGTGG + Intronic
939766949 2:146262651-146262673 CTGAATGGTGAAGGGGAAGGGGG + Intergenic
940051712 2:149471840-149471862 GTCACTGGGGATTTGGAAGTGGG - Exonic
940485623 2:154291716-154291738 CTCTCTGGGGCTGGCCAAGGCGG - Intronic
941068341 2:160928527-160928549 CTTGCTGGGAATAGGGAAGGAGG - Intergenic
941129133 2:161624966-161624988 CTGCCTGGGGATGAGGCAGGGGG - Intronic
941415199 2:165212125-165212147 ATCACTGGTGATGGGAGAGGGGG - Intergenic
942014437 2:171796901-171796923 TAAACTGGGGATAGGGAAGGGGG + Intronic
943129885 2:183841716-183841738 CTCACTGGGGAAGCAGAAGCAGG + Intergenic
943333845 2:186590277-186590299 CTCGCTGGGGCGGGGGGAGGTGG + Exonic
943930415 2:193843939-193843961 CACACTGAGGAAGTGGAAGGAGG + Intergenic
944143796 2:196484735-196484757 CTCCCCGGGGTTGGGGAGGGCGG - Intronic
944515578 2:200509450-200509472 CTGCCTGGGGTTGGGGTAGGAGG - Intronic
944668526 2:201976230-201976252 CACACAGAGGATGGGGAGGGAGG + Intergenic
945079519 2:206074650-206074672 CTCATTGGGGCTGGGCATGGCGG + Intronic
945332572 2:208557048-208557070 CCCACTGGGGTTGGGGGTGGAGG + Intronic
945572448 2:211485703-211485725 CTCAGTGGGGTGGGGGGAGGGGG + Intronic
946038855 2:216766448-216766470 CTCATTTGGGAGTGGGAAGGGGG - Intergenic
946352110 2:219162003-219162025 GACCCTGGGGATGAGGAAGGAGG - Exonic
946619557 2:221546170-221546192 CTATATGGGGATGGGGGAGGGGG + Intronic
947078543 2:226370056-226370078 CTCACTGATGCTGGGGAAGGTGG + Intergenic
947079660 2:226381919-226381941 AACGCTGGGGATGGCGAAGGAGG - Intergenic
947832717 2:233153116-233153138 TTCACTGGGCGTGGGGAAGGTGG + Intronic
948704457 2:239780231-239780253 CACACTGGTGATGGGGAAGGGGG + Intronic
948800205 2:240430026-240430048 GTCCCTGGGGAGGGGGATGGGGG - Intergenic
948807307 2:240458632-240458654 ATGTCTGAGGATGGGGAAGGAGG - Intronic
949069277 2:242013606-242013628 GTCTCTGGGGATGCGAAAGGCGG - Intergenic
1169074484 20:2752528-2752550 CTCACTGGCGAAGGGCGAGGTGG - Exonic
1169422789 20:5473293-5473315 CTCACTGTGGCTGAGGAAAGGGG - Intergenic
1169426636 20:5502182-5502204 CTCACTGTGGCTGAGGAAAGGGG + Intergenic
1169831557 20:9831033-9831055 CCCACTGGGCATGGGATAGGAGG - Intronic
1169858412 20:10127564-10127586 CTCAGTGGGGCTGAGGTAGGAGG + Intergenic
1171349848 20:24494055-24494077 CTCGCTGGGTATGGGGAGGGAGG + Intronic
1173585663 20:44181109-44181131 CTCGCATGGGAAGGGGAAGGTGG - Intronic
1173671913 20:44804838-44804860 GGGATTGGGGATGGGGAAGGGGG + Intronic
1173748087 20:45453386-45453408 CTCACTGGGGATGGGGAGAGAGG + Intergenic
1174225034 20:48991333-48991355 CTCTCTGGGGCTGTGAAAGGCGG + Intronic
1174526370 20:51175223-51175245 CTCTCTGGGCATGGGAAATGGGG - Intergenic
1174786503 20:53437881-53437903 CTCACTGCAGAAGGTGAAGGAGG - Intronic
1175215063 20:57388003-57388025 CTCACTGGGGAGCGGGAGGGAGG - Intergenic
1175295247 20:57903897-57903919 ATCACTGGGGTTGGGGAGGTGGG - Intergenic
1175507721 20:59497774-59497796 TTGCCTGGGGATGGGGAAGTAGG + Intergenic
1175655225 20:60763986-60764008 CCAACTGGGTCTGGGGAAGGAGG - Intergenic
1175769525 20:61614808-61614830 CTCCCTGAGGATGGGGATGAGGG + Intronic
1176026348 20:62987524-62987546 CACAGGGGGGATGGGGATGGGGG + Intergenic
1176389184 21:6154911-6154933 GGGACTGGGGAGGGGGAAGGGGG - Intergenic
1177910052 21:27019815-27019837 AACAGTCGGGATGGGGAAGGAGG - Intergenic
1178201206 21:30407842-30407864 CTCGCTGGGGATGGCAGAGGAGG + Intronic
1178299161 21:31437392-31437414 CTCAGTGGGGCTGAGGTAGGAGG + Intronic
1178352457 21:31882066-31882088 CTCACGAGTGATGGGGGAGGGGG - Intronic
1178360866 21:31947724-31947746 CTGACAGGGGATGGTGGAGGGGG - Intronic
1178375015 21:32059488-32059510 CTCTCTGGGGAAGGGGGAGGTGG + Intergenic
1179123359 21:38569167-38569189 CCCACTGGGGGTGGGGGGGGAGG - Intronic
1179163693 21:38918430-38918452 GTCTCTGGGGTTGGGGATGGTGG + Intergenic
1179286173 21:39979083-39979105 CTCACTGAGCCTGGGCAAGGTGG + Intergenic
1179286296 21:39980035-39980057 GCCACTGGGTTTGGGGAAGGTGG + Intergenic
1179337825 21:40474552-40474574 CTCAGGGGGGAAGGGGAGGGCGG - Intronic
1179734288 21:43383337-43383359 GGGACTGGGGAGGGGGAAGGGGG + Intergenic
1179930977 21:44570560-44570582 GCCACTGAGGATGGAGAAGGAGG + Intronic
1180001106 21:44995951-44995973 CCCACTGAGGCTGGGAAAGGAGG - Intergenic
1180567909 22:16690902-16690924 CACGCCAGGGATGGGGAAGGTGG + Intergenic
1180588951 22:16919393-16919415 CTCACAGAGGGTGGGGAAGGTGG + Intergenic
1180630910 22:17229397-17229419 CTCACTGGGAAGGGGAAAGTTGG - Intergenic
1180961324 22:19763675-19763697 TTCCCTGGGGATGGGGGAAGGGG - Intronic
1180976013 22:19848845-19848867 CTAAAGGGAGATGGGGAAGGTGG + Exonic
1181235140 22:21444008-21444030 CTCAGTGGGGATGGGAAGCGTGG + Intronic
1181350657 22:22255595-22255617 CACACTGGGGCCGGGCAAGGTGG + Intergenic
1181855723 22:25780206-25780228 CTCTCGGGGGATGTGCAAGGGGG + Intronic
1182185430 22:28396685-28396707 CTTAATTGGGATGGGGAGGGAGG - Intronic
1182471766 22:30553293-30553315 CCCACTGGGGATGCTGAATGAGG + Intergenic
1182492437 22:30682393-30682415 CTCACGGGTGAATGGGAAGGGGG + Intergenic
1182705848 22:32279885-32279907 GTCGGTGGGGGTGGGGAAGGTGG + Intergenic
1183024287 22:35052430-35052452 CTGACTGGGGATGGGGATGGTGG - Intergenic
1183142112 22:35952089-35952111 TTGGCTGGGGATGGTGAAGGGGG - Intronic
1183364448 22:37399678-37399700 CTCAGTGGGGGTGGGAGAGGTGG - Intronic
1183463938 22:37969488-37969510 ATCACTGAGGATGTGGAAGGAGG - Intronic
1183986223 22:41572033-41572055 CTCCCTGTGGAAGGGGAAGGTGG - Exonic
1184402049 22:44280070-44280092 CTGAGTGGGGATGGGGGATGGGG - Intronic
1184593314 22:45500049-45500071 CCCAATGGGGATGGAGCAGGTGG - Intergenic
1184665524 22:45987001-45987023 CCCACTGGGGATGGGGAGCAGGG + Intergenic
1184692597 22:46123981-46124003 CTCACTGGGCCTGGGGGAGGTGG + Intergenic
1184960086 22:47922296-47922318 CTTCCTGGGGGTGGGGAAGTAGG + Intergenic
1185229275 22:49670910-49670932 CCGGCTGGGGATGGGGAGGGAGG + Intergenic
1185296166 22:50056385-50056407 CCCACTGCGGGTGGGGACGGGGG + Intronic
949922384 3:9013358-9013380 CTCCCGGGGGCTGGGGAAGATGG + Exonic
949987397 3:9552115-9552137 CTCAGTGGGTATTGGGGAGGGGG - Intronic
950290354 3:11779187-11779209 CTCATGGCAGATGGGGAAGGGGG - Intergenic
950377021 3:12580451-12580473 CTCACTGGGGGTGGTGGCGGGGG - Intronic
950487318 3:13281404-13281426 CTCTCTGTGAATGGAGAAGGAGG - Intergenic
950580412 3:13858324-13858346 CTCCCTGGGGAAGGGGCAGGAGG + Intronic
950669047 3:14514264-14514286 CTCAGTAGGGAGGGGGCAGGAGG + Intronic
951321331 3:21249541-21249563 CTTACAGGGGATGGGGCAAGTGG + Intergenic
952150688 3:30586746-30586768 GTTAGTGAGGATGGGGAAGGTGG + Intergenic
952818581 3:37466537-37466559 TTAACTGGGGATGGGATAGGAGG + Intronic
953851538 3:46468919-46468941 CCCTCTGGGGGTGTGGAAGGAGG - Intronic
953873479 3:46647937-46647959 CTGACAGGGGTTGGGGATGGGGG - Intergenic
953883001 3:46701232-46701254 GTCCCTGGGGATGCGGAAGGTGG + Intergenic
953919613 3:46942951-46942973 GTGACTGGGGTTGGGGGAGGGGG + Intronic
954138786 3:48594616-48594638 CTCACTGGGACTTGGGATGGTGG + Intronic
954374150 3:50185399-50185421 CTCAGTGGGGCTGGGGATGCTGG - Intronic
954713576 3:52516462-52516484 CCCAATGGGGAGGGGGCAGGTGG + Intronic
954759926 3:52866654-52866676 CTCACTTGGCATGTGGAGGGCGG + Intronic
954762930 3:52890112-52890134 CACACTGGAGAGGGGGAATGAGG - Intronic
954791736 3:53138167-53138189 CTCTGTGGGGATGGAGATGGAGG - Intergenic
954877486 3:53811652-53811674 CTCACAGAGGATGGGTGAGGAGG + Exonic
955101573 3:55854834-55854856 TAAACTGGGGATGGGGAAGGAGG + Intronic
955227508 3:57073209-57073231 CAAGCTTGGGATGGGGAAGGTGG + Intronic
955286871 3:57650131-57650153 CTCAGTGGGGAAAGGGAGGGAGG + Intronic
955597319 3:60605826-60605848 ATCACAGGGGATGGGAGAGGAGG + Intronic
956051855 3:65256675-65256697 TTCACCTGGGCTGGGGAAGGGGG - Intergenic
956520074 3:70094383-70094405 TTTAGTGGGGATGGGGAAGTGGG - Intergenic
958133231 3:89456628-89456650 GTCACTGGAAGTGGGGAAGGTGG + Intronic
958915511 3:100045911-100045933 GTCACTGGGGAAGGGGGAGGAGG + Intronic
958967923 3:100579698-100579720 CTCACAGCGGAAGGGGAAGGGGG - Intergenic
959651723 3:108757032-108757054 CTGACTGGGGTAGGGGAAGCGGG - Intronic
961129902 3:124456536-124456558 CTCACTGGAGTTGAGGGAGGTGG - Intronic
961475015 3:127140848-127140870 CTCAGTGGGGTTGGGGTGGGTGG + Intergenic
961486544 3:127221270-127221292 CTCAGTGGGGAAGGGGCAGGGGG + Intergenic
961558672 3:127713920-127713942 TTCACAGAGGTTGGGGAAGGGGG + Intronic
961810846 3:129520932-129520954 CTCTGTGGGGCTGGGGAAGGTGG - Intergenic
962312596 3:134337027-134337049 CTTGGTGGGGATGGGGGAGGAGG + Intergenic
962820046 3:139039595-139039617 CTAACTGGGAATGTGGAAGAAGG - Intronic
963088328 3:141459152-141459174 TTTAGTGGGGGTGGGGAAGGAGG - Intergenic
963233365 3:142931902-142931924 CTCACTGGGGCTGGGCGTGGTGG - Intergenic
963644495 3:147896468-147896490 TTCACAGGGGAGGGGGAAGTGGG - Intergenic
963888173 3:150603719-150603741 AACAGTGGGAATGGGGAAGGAGG + Intronic
965738475 3:171847777-171847799 CACGGTGGGGATGGGGGAGGAGG + Intronic
966689619 3:182729397-182729419 CATACTGGGGGTGGGGATGGAGG - Intergenic
967855283 3:194112787-194112809 CTCCATGGGGATGGAGAAGGAGG + Intergenic
968267660 3:197375213-197375235 CTCTGTGGGGATGGGGAGAGAGG - Intergenic
968440956 4:624166-624188 CTCACTGGGGACGGGGGAGTGGG - Intergenic
968526641 4:1061380-1061402 CTGGCTGGGGAGGGGTAAGGAGG + Intronic
968647903 4:1749229-1749251 CGCAGTGGGGAGGGGGGAGGTGG - Intergenic
968970189 4:3789721-3789743 CTGGCTGGGGTTGGGGAAGGGGG - Intergenic
969054691 4:4394306-4394328 GGCCTTGGGGATGGGGAAGGAGG - Intronic
969624151 4:8293868-8293890 CTCTCCAGGGATGGGGAAGGGGG + Intronic
970441334 4:16083342-16083364 TCCACTGGGGATGGGGGCGGGGG - Intronic
971222731 4:24723578-24723600 AGCACTGGGGTTTGGGAAGGTGG - Intergenic
972676381 4:41263789-41263811 GTCTCTGGGGATAGGGAAGATGG - Intronic
973190104 4:47376799-47376821 CTCACTGGGGTTGAGGAAGAAGG - Intronic
975406455 4:73996242-73996264 CACACTGGGGTTGGGGGTGGGGG - Exonic
980086244 4:128393209-128393231 CTAAGTGGGGAGGGGGAGGGAGG + Intergenic
980563041 4:134502069-134502091 CCCACGGGGGGAGGGGAAGGGGG - Intergenic
982339709 4:154284526-154284548 CTGCCAGGAGATGGGGAAGGTGG - Intronic
984087731 4:175332937-175332959 CTGTCTGGGGATGGGTAAGTGGG - Intergenic
985063981 4:186104460-186104482 CTCTCTGACGATAGGGAAGGTGG - Intronic
986039189 5:3970760-3970782 TTCACTGGAGTTGGGGGAGGCGG + Intergenic
986472712 5:8091884-8091906 CTTAGTGGGGGTGGGGATGGAGG + Intergenic
987186337 5:15423981-15424003 CTCATGGTGGATGGGGAAGCAGG - Intergenic
987257487 5:16171251-16171273 CTCCATGGGGTTGGGGGAGGGGG - Intronic
987514413 5:18887777-18887799 ATCACTGTGGAAGGGGAAGTAGG + Intergenic
987782232 5:22454125-22454147 CTTACTGTCCATGGGGAAGGGGG + Intronic
988866455 5:35340364-35340386 CTCACTGGGGCTGGGTGTGGTGG + Intergenic
989750206 5:44884015-44884037 CCCACTGGGGGTGGGGGGGGCGG + Intergenic
991020874 5:61978730-61978752 CTAACTGGTTATGGTGAAGGTGG - Intergenic
991355273 5:65762576-65762598 CTCAGTGGTGTTGGGGAAGAGGG + Intronic
991657695 5:68920511-68920533 TTCACAGGGGATGGGGAAGTTGG + Intergenic
991658017 5:68922554-68922576 TTCACAGGGGATGAGGAAGTTGG - Intergenic
992164404 5:74034905-74034927 CTCACAGGGCATTTGGAAGGTGG - Intergenic
992749518 5:79849506-79849528 CTCAGTGGGCATGAGTAAGGAGG + Intergenic
992958567 5:81936040-81936062 AACACGGGGGCTGGGGAAGGAGG + Intergenic
993889358 5:93454692-93454714 ATCTCCGGGGATGGGGAAAGGGG + Intergenic
994981981 5:106887202-106887224 CTCACTGGGGTTGAGAAAGTAGG - Intergenic
995283807 5:110364316-110364338 CACACTGAGGATGGAGGAGGGGG - Intronic
995848048 5:116515077-116515099 TTCACTGTGGAGGGGGCAGGTGG + Intronic
997136031 5:131327310-131327332 CTCACTGGGGATGGGGAGTCAGG - Intronic
997183880 5:131861494-131861516 TTTAATGGGCATGGGGAAGGTGG + Intronic
997246751 5:132356232-132356254 CTCACAGTGGAAGGTGAAGGGGG - Intergenic
997262170 5:132473744-132473766 CTCACTGAGGTTTGGGGAGGGGG + Intronic
997294820 5:132762743-132762765 ATCCCTGGGCAGGGGGAAGGAGG + Intronic
997607474 5:135185502-135185524 CTCATGGGGGAAGGGGAAGCAGG - Intronic
997846760 5:137293571-137293593 CACACTGGGGAGGGGCAAGGTGG - Intronic
998023615 5:138793899-138793921 CCCTCAGGGGATGGGGAAGGGGG + Intronic
998460560 5:142307049-142307071 CCCACTGGGCATGGTGGAGGGGG - Intergenic
998850133 5:146344129-146344151 CTCCCTGGGAATGGGGATCGGGG + Intergenic
999673210 5:153975318-153975340 CTAGCTGGGTCTGGGGAAGGGGG - Intergenic
999719752 5:154390903-154390925 CTCATCCGGGAGGGGGAAGGAGG + Intronic
1001003075 5:168025969-168025991 CTCACTTGCGATGGGGAACTGGG + Intronic
1001174026 5:169448219-169448241 CACACTGGGGAGGGAGAAGTGGG - Intergenic
1001374139 5:171238632-171238654 CTTTCTTGGGAAGGGGAAGGAGG + Intronic
1001425408 5:171619237-171619259 CTCCCTGGGGCTGGGGGTGGAGG - Intergenic
1001591587 5:172869187-172869209 CCCCCTGGGGAGGAGGAAGGAGG + Intronic
1001606240 5:172961967-172961989 CTTACTGGAGATGTGGAAGATGG - Intronic
1002066514 5:176654663-176654685 CTCTCTTGGGTCGGGGAAGGGGG + Intronic
1002309801 5:178307464-178307486 CTCCCTGGCTCTGGGGAAGGAGG - Intronic
1004667315 6:17760681-17760703 CCCACTGGGGAGGGGAAAGGAGG + Intronic
1005512749 6:26526078-26526100 GTCACTGGGGATGGTGAAAGAGG + Intergenic
1006153559 6:32002010-32002032 CTCCATGGGGGTGGCGAAGGTGG + Intronic
1006159867 6:32034747-32034769 CTCCATGGGGGTGGCGAAGGTGG + Intronic
1006445034 6:34075256-34075278 GTCACTGGAGTTGGGGAAGGTGG - Intronic
1006457213 6:34138681-34138703 CTCGCAGGCCATGGGGAAGGTGG + Intronic
1006509797 6:34515692-34515714 CTTGCTGGGGATGGGCATGGGGG - Intronic
1006851535 6:37102392-37102414 CTCCCTGGGGGAGGGGGAGGAGG - Intergenic
1006975591 6:38097893-38097915 GTCAGTGGAGATAGGGAAGGAGG + Intronic
1007034287 6:38658812-38658834 TTGCCTGGGGATGGGGATGGTGG - Intergenic
1007251600 6:40499075-40499097 CTCACTTAGAATGAGGAAGGAGG + Intronic
1007637006 6:43305709-43305731 CCCATGGGGGTTGGGGAAGGTGG - Exonic
1008627473 6:53331934-53331956 CTCACTGTGAAAGGTGAAGGGGG + Intronic
1008909267 6:56715893-56715915 TTCACAGGGGAGAGGGAAGGGGG - Intronic
1009289667 6:61867804-61867826 CTCCCAGAGGATGGGGCAGGCGG - Intronic
1009905501 6:69866545-69866567 CTCCCTGCGAGTGGGGAAGGGGG - Intergenic
1010718991 6:79261778-79261800 CTCCCTGGGCAGGGGAAAGGCGG - Intergenic
1012155181 6:95810710-95810732 CTGAATGGGGGTGGTGAAGGAGG - Intergenic
1012509100 6:99982275-99982297 CTGAGTAGGGTTGGGGAAGGTGG - Intronic
1013284028 6:108664859-108664881 ATCACTGAGGAAGGGGAAGTGGG + Exonic
1013604869 6:111738463-111738485 CTCACTGGAGAGGGGTAATGGGG + Intronic
1014681309 6:124433648-124433670 CTAGCTGGGGAATGGGAAGGGGG + Intronic
1016153856 6:140780103-140780125 CTGACAGGGGATGGGGAATGGGG - Intergenic
1017143969 6:151217124-151217146 CTGAGTGGGGATGGGAATGGAGG + Intergenic
1017611401 6:156190324-156190346 CCCAATGGGGATGGAGATGGGGG - Intergenic
1017762922 6:157584915-157584937 CTGACTTGGGATGGGCACGGTGG + Intronic
1017797021 6:157854198-157854220 CTCACTGGGGGTGGGGAGACAGG - Intronic
1018616248 6:165689646-165689668 CTCACGGCGGAAGAGGAAGGGGG - Intronic
1019120367 6:169798967-169798989 CTCCCAGAGGCTGGGGAAGGTGG + Intergenic
1019348310 7:541320-541342 CTCCCTGGGAGTGGGGGAGGGGG - Intergenic
1019348356 7:541428-541450 CTCCCTGGGGGTGGGGTAGGGGG - Intergenic
1019563747 7:1669961-1669983 CGCGCAGGGGCTGGGGAAGGAGG - Intergenic
1019851325 7:3561077-3561099 TGCACTAGGGGTGGGGAAGGGGG - Intronic
1021181936 7:17517374-17517396 CTCATATGGCATGGGGAAGGAGG + Intergenic
1021998053 7:26200338-26200360 TTCACTGGGGGTGGGGGATGGGG - Intronic
1022500267 7:30878294-30878316 CTCACTGGGTATGTGGGAGGAGG + Intronic
1022627371 7:32051649-32051671 TTCAGTGGGGATGGGCATGGGGG + Intronic
1022797125 7:33741062-33741084 TTGTCTGGGGCTGGGGAAGGGGG - Intergenic
1022828927 7:34045363-34045385 TTAACTGGGGCTGGGGAAGCAGG + Intronic
1022941999 7:35250046-35250068 CTCACTGGGGATGATGGGGGTGG + Exonic
1023505832 7:40898971-40898993 CTCCTTGGGGCTGGGGAGGGGGG + Intergenic
1024110854 7:46145117-46145139 TTCACTGGGCATTGGGAAGGAGG + Intergenic
1024210478 7:47199015-47199037 CTCACATGGCAGGGGGAAGGCGG + Intergenic
1024410517 7:49036109-49036131 ATCACTGAGCATGTGGAAGGGGG - Intergenic
1024550467 7:50558810-50558832 CTCACTGGGGATGGGGAAGGTGG + Intronic
1024568216 7:50702040-50702062 CTCAGTGGGGAGGGGGAGGCAGG - Intronic
1026314953 7:69220168-69220190 CTCCCTGGGGCTGGGTATGGTGG - Intergenic
1026366777 7:69656170-69656192 CACACTGGGGAAGGGGCAGAGGG - Intronic
1026505847 7:70982407-70982429 TTCACAGGGGATGGGCAAAGTGG - Intergenic
1026911676 7:74094856-74094878 CTCCATGGGGGTGGGGAATGCGG - Intronic
1027406220 7:77864065-77864087 CTCCGTGGGGCTGGGTAAGGTGG - Intronic
1028332480 7:89611669-89611691 CTCACTGGGGGTGGGGCTGGGGG + Intergenic
1028864471 7:95691830-95691852 CTGCCTGGAGGTGGGGAAGGTGG + Intergenic
1029021095 7:97365069-97365091 TTTACTGGGGATGGGACAGGAGG - Intergenic
1029308023 7:99635572-99635594 CTGACTGGAAATGGGGGAGGGGG - Intergenic
1029389120 7:100263164-100263186 CTCAGTGGGGCTGAGGCAGGAGG + Intronic
1029547543 7:101218240-101218262 CTGACTTGGGAAGGGGAAGGGGG - Intronic
1029688649 7:102165843-102165865 TTCTCTGGGGAAGGTGAAGGAGG - Intronic
1030070134 7:105691080-105691102 GTCACGGGGGAGGGGGACGGAGG - Intronic
1031493667 7:122420901-122420923 CCTACTGGGGAAGGGGAGGGAGG + Intronic
1031542089 7:123006833-123006855 CGCTCTGGGGAAGGGAAAGGAGG + Intergenic
1032087851 7:128893097-128893119 GTCAGCGGGGATGGCGAAGGTGG - Intronic
1032340977 7:131072767-131072789 TTCACTTGAGATTGGGAAGGAGG + Intergenic
1033424267 7:141229413-141229435 GGAACTGGGGATGGGGTAGGTGG - Intronic
1033913001 7:146287202-146287224 CTTCCTGGGGAGTGGGAAGGAGG + Intronic
1034486473 7:151367683-151367705 ACCACAGGGGATGGGGAAGAGGG + Intronic
1034926263 7:155124885-155124907 CTCACTGGTGATGAGGAGAGTGG + Intergenic
1035415915 7:158685911-158685933 CTCACTGGGCATTTGGAACGTGG - Intronic
1035569425 8:662225-662247 CTTGCAGGGGATGGAGAAGGTGG + Intronic
1035854553 8:2960366-2960388 CTCACGAGAGATGGGGAAAGTGG + Intronic
1036158746 8:6366958-6366980 CTGACTGGGGCTGGGGAAGGAGG - Intergenic
1036591495 8:10172718-10172740 CTCACCAGAGATGGGAAAGGAGG + Intronic
1037338427 8:17814597-17814619 ATCACTGTGGAAGGGGAAGCAGG + Intergenic
1037496269 8:19443873-19443895 CACACTGGGGGTGGGGGTGGAGG + Intronic
1037708077 8:21332470-21332492 ATGATTGGGGCTGGGGAAGGTGG + Intergenic
1037753911 8:21699451-21699473 CTCCCTGGTGCTGGGAAAGGTGG + Intronic
1037801938 8:22040677-22040699 CTCACTGGCCATGGGGACAGTGG - Intergenic
1037811753 8:22090483-22090505 TTGACTGGGGATGGGGGAAGGGG - Intronic
1037820759 8:22133553-22133575 CTGGTGGGGGATGGGGAAGGGGG + Intergenic
1037830562 8:22186160-22186182 CTGGCTGGGGATGTGGAAGTCGG - Intronic
1038174502 8:25168052-25168074 CTCAGTGGGGCTGAGGCAGGAGG - Intergenic
1038480869 8:27901183-27901205 CTCACTAGGGACGTGGAAGTTGG - Intronic
1038481103 8:27902323-27902345 CTCCCTGGGGATGGGTGGGGAGG - Intronic
1039466775 8:37790192-37790214 GACAAAGGGGATGGGGAAGGAGG - Intronic
1039573755 8:38607097-38607119 CTCACTAGGGATGAGAGAGGAGG + Intergenic
1040387279 8:46922052-46922074 ACCTTTGGGGATGGGGAAGGCGG + Intergenic
1040744116 8:50619442-50619464 CTCACAGGGGCCGGGCAAGGTGG + Intronic
1040849337 8:51882362-51882384 TGCACTGGGCATGGGGTAGGGGG + Intronic
1042482050 8:69315167-69315189 CTCATTGGAGATGGGGGAAGTGG - Intergenic
1042795826 8:72662369-72662391 CTCAGTGGGGCTGGGGAGGGAGG + Intronic
1043534502 8:81187453-81187475 TTCACTGGGGAAAGGGGAGGAGG + Intergenic
1043912816 8:85883270-85883292 CTCACTGGGGCTGATGATGGAGG - Intergenic
1044262784 8:90147217-90147239 AGCTCTGGGGATGGGCAAGGGGG + Intergenic
1044275798 8:90298014-90298036 TTCAGTGGGGCTGGGGCAGGAGG - Intergenic
1044303263 8:90609432-90609454 CTCACTGGTGATGGGTCTGGAGG + Intergenic
1044980692 8:97713370-97713392 CTCACTGAGGCTGGGCACGGTGG - Intronic
1045119559 8:99021333-99021355 CTCACTGTGGCTGGGCACGGTGG + Intronic
1045556519 8:103219565-103219587 CTAAGTGTAGATGGGGAAGGGGG + Intronic
1046007739 8:108506230-108506252 CTCACCGGGGAAGCGCAAGGGGG - Intergenic
1046631011 8:116623248-116623270 CTCACAGGGAATGGAGAAAGGGG - Intergenic
1046695254 8:117332747-117332769 CCCACTGGGAATGGGTGAGGGGG + Intergenic
1046778094 8:118185382-118185404 CTCAGTGGGAAGGGAGAAGGGGG - Intergenic
1047137463 8:122096546-122096568 CTCAGTTGGGATGGGGAGGCTGG - Intergenic
1047451030 8:124965142-124965164 CTGACAGGAGATGGGGACGGGGG - Intergenic
1047487063 8:125341004-125341026 CTCACTGGGCATGTGGTCGGGGG + Intronic
1048866354 8:138764474-138764496 ATCAGTGGGTATGGGGAATGGGG - Intronic
1048970672 8:139643450-139643472 CTCACTGGGGAAGGGGCTGCAGG + Intronic
1049246550 8:141565808-141565830 CTCTGTGAGGGTGGGGAAGGAGG + Intergenic
1049377490 8:142296117-142296139 GTCACTGTGGAAGAGGAAGGTGG + Intronic
1049407026 8:142456139-142456161 CTCTCTGGGGCTGGGGAACAGGG - Intronic
1049971604 9:826606-826628 CTCACCGGGGGCGGGGATGGAGG - Intergenic
1051039179 9:12785312-12785334 CTGTCTGGGGCTGGGGGAGGGGG + Intronic
1054809893 9:69426354-69426376 CAGTCTGGGGATGGGGAAGTAGG + Intergenic
1055522074 9:77091501-77091523 CTCACTTTGGAAGGAGAAGGAGG - Intergenic
1056144255 9:83713857-83713879 AACACTGGGGCAGGGGAAGGTGG + Intergenic
1056182984 9:84103438-84103460 GACACTGGGGAGGGGGAGGGAGG + Intergenic
1056659536 9:88534414-88534436 CGCAGTGGGGATGGGGGCGGGGG + Intergenic
1056739233 9:89238640-89238662 CTGCCTAGGGATGGGGGAGGTGG + Intergenic
1056914210 9:90730631-90730653 CTGAGTGGGGACAGGGAAGGGGG - Intergenic
1057007569 9:91574029-91574051 CTCAGTGGGGCTGAGGCAGGAGG + Intronic
1057220136 9:93253105-93253127 GGTAATGGGGATGGGGAAGGGGG - Intronic
1057292268 9:93814264-93814286 CTCAAGGGGGACGAGGAAGGTGG - Intergenic
1058416492 9:104794254-104794276 GTCACTGGGCATGGGGGTGGGGG + Intronic
1058706732 9:107643717-107643739 ATCACTGGGGCCGGGCAAGGTGG - Intergenic
1058935077 9:109762842-109762864 CCCCCTGGGGAATGGGAAGGAGG - Intronic
1059323854 9:113490320-113490342 TTCACTGGAGAAGGGGAAAGTGG - Intronic
1059398481 9:114053857-114053879 CTCACTGGTGATGCGGCAGGTGG - Exonic
1059446683 9:114342506-114342528 CTCACTGTGGTTGGGGCGGGGGG - Intronic
1059498010 9:114726159-114726181 GTCTCTGGGGATGAGGCAGGAGG + Intergenic
1060634411 9:125189157-125189179 GTCTCTGAGGAAGGGGAAGGCGG - Intronic
1060839270 9:126781394-126781416 CTCCCAGGTGATGGGGAAGGGGG + Intergenic
1061374545 9:130216117-130216139 TTCATTGGGGAGGGGGACGGTGG + Intronic
1061455118 9:130692039-130692061 AGCACTGGGGATGGGAGAGGGGG + Intergenic
1062249896 9:135588744-135588766 GTCACTGGGGCTGGGGCTGGTGG + Intergenic
1062267297 9:135693030-135693052 CTCACTGTGCATGGGGAATAGGG - Intergenic
1062283647 9:135763265-135763287 CTCACTGGCGATGGTAAGGGTGG + Intronic
1062536736 9:137024337-137024359 CTCCCTGGGGCCAGGGAAGGTGG + Intronic
1062541109 9:137041961-137041983 CTGCCTGGGGACGGGGAAGTGGG + Intronic
1185608514 X:1380612-1380634 ATGAGTGGGGAGGGGGAAGGAGG + Intronic
1185620688 X:1451159-1451181 CCCCCTAGGGATGGGGAGGGAGG - Intronic
1185620979 X:1451903-1451925 CCCCCTAGGGATGGGGAGGGAGG - Intronic
1186506590 X:10098310-10098332 CTGGCTGGGGAGGGGGGAGGGGG - Intronic
1186531305 X:10298566-10298588 TTCACTGTGGATGGTAAAGGTGG + Intergenic
1187765776 X:22640229-22640251 CTCACTGAGTATAGGGCAGGAGG - Intergenic
1187817531 X:23248987-23249009 CCCACTAGGTATGGGCAAGGAGG - Intergenic
1187935860 X:24335199-24335221 GTCACTGGGGCGGGGGTAGGGGG - Intergenic
1189508767 X:41639743-41639765 CTGACTGGGGATGGGGATGGGGG - Intronic
1189652786 X:43208265-43208287 GTCACTGGGGAAGGGAAATGTGG + Intergenic
1190259013 X:48786494-48786516 CTCCCTGGGGAGGAGGGAGGAGG + Intergenic
1190298193 X:49040748-49040770 CACAGTGGGGAAGGGAAAGGGGG - Intronic
1190341870 X:49303531-49303553 CTCAGTGGGGATGGGAATCGAGG + Intergenic
1190344086 X:49321921-49321943 CTCAATGAGGATGGGCATGGAGG + Intergenic
1190345180 X:49331466-49331488 CTCAATGAGGATGGGCATGGAGG + Intergenic
1190346274 X:49341032-49341054 CTCAATGAGGATGGGCATGGAGG + Intergenic
1190347526 X:49532061-49532083 CTCAATGAGGATGGGCATGGAGG + Intergenic
1190348627 X:49541617-49541639 CTCAATGAGGATGGGCATGGAGG + Intergenic
1190349728 X:49551173-49551195 CTCAATGAGGATGGGCATGGAGG + Intergenic
1190350832 X:49560726-49560748 CTCAATGAGGATGGGCATGGAGG + Intronic
1190351933 X:49570284-49570306 CTCAATGAGGATGGGCATGGAGG + Intergenic
1190353034 X:49579833-49579855 CTCAATGAGGATGGGCATGGAGG + Intergenic
1190354135 X:49589380-49589402 CTCAATGAGGATGGGCATGGAGG + Intergenic
1190355237 X:49598904-49598926 CTCAATGAGGATGGGCATGGAGG + Intronic
1191799915 X:65066950-65066972 ATCACTGAGGATGGAGTAGGTGG - Intergenic
1192134993 X:68588859-68588881 CTCCCTGTGGTTGGGGGAGGAGG - Intergenic
1192796537 X:74428267-74428289 CTCCTTGTGGATGGGGAATGTGG + Intronic
1193397826 X:81006282-81006304 CTCTGGGGGAATGGGGAAGGTGG - Intergenic
1195922980 X:110001787-110001809 TGCTCTGGGGAGGGGGAAGGGGG + Intergenic
1196560592 X:117143159-117143181 CTCCATGGAGTTGGGGAAGGAGG + Intergenic
1197998524 X:132406989-132407011 GTTATTGGGGAAGGGGAAGGTGG + Intronic
1198228670 X:134669656-134669678 AGCACTTGGGATGGGGAAAGGGG + Intronic
1198462913 X:136880507-136880529 CTCCCTGGAGATGGGGGTGGCGG - Intronic
1198842733 X:140876459-140876481 CTCCCTGGAGATGAGGAAAGGGG - Intergenic
1198980678 X:142391409-142391431 CTCACTCGGGAAGCGCAAGGGGG - Intergenic
1198985568 X:142448747-142448769 CTTAGTGGGGTTGAGGAAGGTGG - Intergenic
1199430354 X:147752818-147752840 CTCAAAGGGGATTGAGAAGGAGG - Intergenic
1199862112 X:151810405-151810427 CTCACTGGGGATAAGGTAGAGGG - Intergenic
1201575057 Y:15454639-15454661 CTCACTGGGCAGGGGGAAGGTGG + Intergenic