ID: 1024551218

View in Genome Browser
Species Human (GRCh38)
Location 7:50564020-50564042
Sequence CACCCTGGTCTCCAGGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 3, 2: 0, 3: 39, 4: 308}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024551218_1024551223 -9 Left 1024551218 7:50564020-50564042 CCCCTTTCCTGGAGACCAGGGTG 0: 1
1: 3
2: 0
3: 39
4: 308
Right 1024551223 7:50564034-50564056 ACCAGGGTGGCGTGAAGCTCAGG 0: 1
1: 0
2: 2
3: 9
4: 116
1024551218_1024551227 -4 Left 1024551218 7:50564020-50564042 CCCCTTTCCTGGAGACCAGGGTG 0: 1
1: 3
2: 0
3: 39
4: 308
Right 1024551227 7:50564039-50564061 GGTGGCGTGAAGCTCAGGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 205
1024551218_1024551225 -8 Left 1024551218 7:50564020-50564042 CCCCTTTCCTGGAGACCAGGGTG 0: 1
1: 3
2: 0
3: 39
4: 308
Right 1024551225 7:50564035-50564057 CCAGGGTGGCGTGAAGCTCAGGG 0: 1
1: 0
2: 1
3: 30
4: 375
1024551218_1024551228 5 Left 1024551218 7:50564020-50564042 CCCCTTTCCTGGAGACCAGGGTG 0: 1
1: 3
2: 0
3: 39
4: 308
Right 1024551228 7:50564048-50564070 AAGCTCAGGGGTGGCACTGTAGG 0: 1
1: 0
2: 2
3: 10
4: 198
1024551218_1024551226 -7 Left 1024551218 7:50564020-50564042 CCCCTTTCCTGGAGACCAGGGTG 0: 1
1: 3
2: 0
3: 39
4: 308
Right 1024551226 7:50564036-50564058 CAGGGTGGCGTGAAGCTCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 213
1024551218_1024551229 12 Left 1024551218 7:50564020-50564042 CCCCTTTCCTGGAGACCAGGGTG 0: 1
1: 3
2: 0
3: 39
4: 308
Right 1024551229 7:50564055-50564077 GGGGTGGCACTGTAGGCAGATGG 0: 1
1: 0
2: 4
3: 32
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024551218 Original CRISPR CACCCTGGTCTCCAGGAAAG GGG (reversed) Intronic
900674616 1:3877037-3877059 TCCCCAGGGCTCCAGGAAAGGGG - Intronic
901441483 1:9280998-9281020 AACCCTGCTTTCCAGAAAAGAGG + Intergenic
901760216 1:11466181-11466203 CACCTTGGTATCCAGCACAGTGG + Intergenic
902622021 1:17656211-17656233 GCCCCTGGTCTCCAGGAAGGTGG + Intronic
903262746 1:22140096-22140118 CACCCTGGACTCCAGGGTATTGG + Intronic
905471015 1:38191746-38191768 CGCCCTGGTTTGCAGGAGAGAGG + Intergenic
905990873 1:42335643-42335665 TAGCCTCCTCTCCAGGAAAGCGG + Intronic
906723180 1:48023926-48023948 AACCCTCCTCCCCAGGAAAGTGG - Intergenic
906753959 1:48291484-48291506 CACACAGGTCACCAGGGAAGTGG + Intergenic
906874787 1:49525660-49525682 CACCCTGCTCACCAGGGAAGAGG + Intronic
908384134 1:63624516-63624538 CCCACTGGTTTCCAGGAAGGTGG + Intronic
909147984 1:71962168-71962190 GACTCTTGTCTTCAGGAAAGAGG - Intronic
909572919 1:77138077-77138099 CTGCCTATTCTCCAGGAAAGTGG - Intronic
911169722 1:94757928-94757950 CAGTCTGGTCCCCAGAAAAGTGG + Intergenic
912033130 1:105274703-105274725 CACACAGGTCTCCAGGGAATTGG + Intergenic
913165386 1:116180152-116180174 CACCCTGGTGTCCAGAACAATGG - Intergenic
913236185 1:116785281-116785303 CACACAGGTCTCCAGGGAAGTGG - Intergenic
915517454 1:156421547-156421569 CACCCTGGGCTCGATGTAAGTGG - Intronic
916116209 1:161487082-161487104 CAGCCTGGTCTCTAGTAGAGGGG + Intergenic
917776576 1:178342989-178343011 CACAATGGTCTCCAGAAAAATGG - Intronic
918159074 1:181880378-181880400 CACACAGGTCACCAGGGAAGTGG - Intergenic
919281782 1:195499438-195499460 CACCCTGAACTCAAGGCAAGAGG - Intergenic
919775764 1:201193042-201193064 CTCCCTGGTCTCTGGGAAATTGG + Intronic
920126200 1:203695512-203695534 CACCCTGGCCTCCAGCTTAGGGG - Intronic
920799926 1:209176944-209176966 CACACAGGTCACCAGGGAAGTGG - Intergenic
923092062 1:230748216-230748238 CACCCTGATCTCTGGGAATGGGG - Intronic
923468513 1:234269467-234269489 CACACTGGGCTGCAGGAAGGAGG - Intronic
924611944 1:245580634-245580656 CTCCCTGGACACCAGGAGAGTGG + Intronic
924632114 1:245750948-245750970 AAGCCTGCTCTCCAGGAATGAGG + Intronic
1063207957 10:3853091-3853113 CACCCAGGTCTGCAGGAGGGTGG + Intergenic
1064017952 10:11787367-11787389 CACCTTGGAGTCCAGGAAAAGGG - Intergenic
1064119219 10:12604820-12604842 CACACTAGTCTCCAGGAAAAGGG - Intronic
1065462337 10:25982128-25982150 CACACAGGTCACCAGCAAAGTGG - Intronic
1065736065 10:28753574-28753596 CGCCTTTGCCTCCAGGAAAGTGG + Intergenic
1066591529 10:37000253-37000275 GCGCCTGGACTCCAGGAAAGGGG - Intergenic
1066978507 10:42390648-42390670 CACCCCAGTATCCAGGAGAGAGG + Intergenic
1067046468 10:42988167-42988189 TACGCTGGACTCCAGGAAAAGGG - Intergenic
1067187638 10:44043941-44043963 CTCCCTGAATTCCAGGAAAGCGG - Intergenic
1067462544 10:46468396-46468418 GACCCTGGACTCCAGCAAGGGGG - Intergenic
1067624651 10:47916241-47916263 GACCCTGGACTCCAGCAAGGGGG + Intergenic
1067877758 10:50020112-50020134 TGCCCGGGTCTCCAGGAATGGGG + Intergenic
1068120024 10:52775444-52775466 CACCCTAGTCTACAAAAAAGGGG - Intergenic
1068946263 10:62732553-62732575 AACACAGGGCTCCAGGAAAGGGG + Intergenic
1069710908 10:70488148-70488170 CAGCCTGGGCAACAGGAAAGAGG - Intronic
1070442254 10:76458215-76458237 CACCCTTGTCTGGAGGAGAGGGG - Intronic
1070734830 10:78856273-78856295 CAGGCTTCTCTCCAGGAAAGTGG - Intergenic
1070757747 10:79003925-79003947 CACCCTGTCTTCCAGGAAACAGG - Intergenic
1071870572 10:89789761-89789783 CATGCAGGTCTCCAGGGAAGTGG + Intergenic
1071932154 10:90484661-90484683 CATGCAGGTCTCCAGGGAAGTGG + Intergenic
1073541532 10:104319456-104319478 CACCCTGGCCCCCAGCAAAGGGG + Intronic
1076242225 10:128917065-128917087 GACCCTGCTCTCCAGGCAACCGG - Intergenic
1076546565 10:131249366-131249388 CACCCGGGTCCCCAGTATAGGGG + Intronic
1076982082 11:209967-209989 CACCCTGGACTCCATCAAGGGGG + Exonic
1077611377 11:3645118-3645140 CACCATGGCCACCAGGAGAGGGG - Exonic
1078549760 11:12272038-12272060 CTCCCTGGGCTCCAGGAGGGTGG - Intergenic
1081709550 11:45208089-45208111 CCCCCTGGTGTCCACCAAAGTGG + Intronic
1082120883 11:48378546-48378568 CATACAGGTCACCAGGAAAGTGG + Intergenic
1082252957 11:50002096-50002118 CATACAGGTCACCAGGAAAGTGG - Intergenic
1083433332 11:62626327-62626349 CACCCTTGTCTCCAGGTAATGGG - Exonic
1083442695 11:62687721-62687743 CAGCCTGGCCCCCGGGAAAGAGG - Exonic
1083714077 11:64565702-64565724 GGCCATGGTCTCTAGGAAAGTGG - Intronic
1083722573 11:64610736-64610758 CACCCTGGTCTCCAGGTAAGGGG + Intronic
1084007029 11:66328521-66328543 CACCCTGCAACCCAGGAAAGCGG + Intergenic
1084147349 11:67272136-67272158 CATCCTGGGTTCCAGGGAAGGGG + Intronic
1084525765 11:69697153-69697175 CTCCCTGCTCTCCAGTAAAAGGG - Intergenic
1084713684 11:70860139-70860161 CACCTTGGTCTGGAGCAAAGAGG - Intronic
1085051082 11:73380601-73380623 CAGCCTGGTCTCCAGGCAGGAGG + Intronic
1085100139 11:73793878-73793900 GACCCTGTTCTCCAGAAAAAGGG - Intronic
1085896768 11:80649020-80649042 GGGCCTGGACTCCAGGAAAGGGG + Intergenic
1086297602 11:85388190-85388212 CACACGGGTCACCAGGGAAGTGG - Intronic
1087902006 11:103651434-103651456 CATCCAGGTCACCAGGGAAGAGG - Intergenic
1089068022 11:115676767-115676789 GACTCTCGTCTCCAGGTAAGAGG + Intergenic
1089169968 11:116505041-116505063 CACCCTGTATTCCAGGAAGGGGG - Intergenic
1089775072 11:120830315-120830337 CAGCCTGGTCTCATGGTAAGAGG + Intronic
1090307256 11:125702194-125702216 CACACAGCTCACCAGGAAAGTGG - Intergenic
1091034204 11:132218474-132218496 CGCCCAAGTCTCTAGGAAAGAGG + Intronic
1091588463 12:1829147-1829169 CACCTTGATCTCCAGGGAGGTGG + Intronic
1092011360 12:5115415-5115437 CTCCATGGTCTCCAGGAGTGTGG - Intergenic
1092124714 12:6066943-6066965 CTGCCTGGTCCCCAGGACAGTGG + Intronic
1092628962 12:10358451-10358473 CTCGCTGGGCTCCAGGAAAGTGG + Intergenic
1094503042 12:31037217-31037239 GGCCCTGCTCTCAAGGAAAGGGG + Intergenic
1095997948 12:48105584-48105606 CACTCGGGTCTCAAGGAAGGCGG + Exonic
1096472723 12:51889331-51889353 AAGCTTGGTCCCCAGGAAAGGGG - Intronic
1097180282 12:57167868-57167890 CACCAAGGACTCCAGGAAATGGG - Intronic
1100125092 12:91415144-91415166 CACCCTGTCCTCCAGGAAACAGG - Intergenic
1100868577 12:98885871-98885893 CAAACTGGTCTCCAAGAAGGTGG + Intronic
1100918535 12:99455653-99455675 CGCACAGGTCACCAGGAAAGTGG - Intronic
1102244027 12:111343582-111343604 GACCCTGGTGCCCAGGAGAGAGG - Intronic
1102451215 12:113043434-113043456 CAGCCTGGCCTCCAGCCAAGTGG - Intergenic
1102918199 12:116771344-116771366 CACCCTAGTCTCCAGGGTAGCGG - Intronic
1102961750 12:117098056-117098078 CATCCAGTTCTCCTGGAAAGGGG + Intronic
1103037075 12:117665251-117665273 CGCCCTGGTCTCCACCTAAGAGG - Intronic
1103443479 12:120979738-120979760 CACCCAGTTCTCCAGGAGACGGG - Intronic
1103936622 12:124480791-124480813 GACCCTGGACTCCAGGCGAGTGG + Intronic
1104169255 12:126264021-126264043 CACCCTGTTCTCCAGGAAAGTGG + Intergenic
1105534056 13:21247704-21247726 CAGCCTGGTCTGCAGGGAGGGGG - Intergenic
1106157884 13:27173933-27173955 CTCCCTGGTCTCAAGGAAGTTGG - Intergenic
1109484572 13:63001941-63001963 CACACAGGTCCCCAGGGAAGTGG - Intergenic
1110504723 13:76272157-76272179 CACACAGGTCACCAGGGAAGTGG - Intergenic
1111899935 13:94188299-94188321 CACCCCTGTCTCCTGGGAAGAGG - Intronic
1112281716 13:98068689-98068711 CACCCTGTTCTTCAGGAACGCGG + Intergenic
1112497263 13:99915123-99915145 TACCCTGGTTTCCTGGAAGGAGG - Intergenic
1113328819 13:109309476-109309498 CTCACTGGCCCCCAGGAAAGAGG - Intergenic
1113432231 13:110261196-110261218 CAGCCTGCTCCCCAGGAAGGGGG + Intronic
1113601069 13:111568569-111568591 CACACTGGCCTCCAGGAACCAGG - Intergenic
1114131958 14:19801421-19801443 CAGCCTGGTCTCCAGTACAGCGG - Intronic
1114329020 14:21617619-21617641 CACGCAGGTCTCCAGGGAAGTGG + Intergenic
1114753825 14:25235800-25235822 CACTGTGGACTACAGGAAAGTGG + Intergenic
1117508934 14:56429423-56429445 TCCCCAGGTCTCCAGGAGAGGGG - Intergenic
1118163002 14:63309682-63309704 CAGCTTGGTCTCCAGGCAAGGGG + Intergenic
1118324580 14:64772526-64772548 CACCCAGGGCTCCTGGAAATTGG + Intronic
1118442205 14:65822132-65822154 CACCAAGGTCTCCAGGGCAGTGG - Intergenic
1118464120 14:66015363-66015385 CACCTTGATCTGCACGAAAGAGG + Intergenic
1118747632 14:68785589-68785611 CACCCTGGCCTCCAGGGTAAGGG + Intergenic
1119871945 14:78025563-78025585 CAAAATGGTCTCTAGGAAAGAGG + Intergenic
1121114097 14:91331478-91331500 CACCATGGTGACCAGGAACGGGG - Intronic
1121252636 14:92511348-92511370 CTCCCTGGACCCCAGGGAAGCGG - Intergenic
1121565835 14:94908507-94908529 CGCCCAGGTCTCCAGGGGAGGGG - Intergenic
1122842524 14:104473327-104473349 CTCCCAGGACCCCAGGAAAGGGG - Intergenic
1123575038 15:21657144-21657166 CAGCCTGGTCTCCCGTACAGCGG - Intergenic
1123611654 15:22099633-22099655 CAGCCTGGTCTCCCGTACAGCGG - Intergenic
1123881188 15:24678381-24678403 TACCTTTGTCTCCAGGAAGGAGG + Exonic
1125388660 15:39167811-39167833 CACACTTATTTCCAGGAAAGAGG + Intergenic
1125589003 15:40843416-40843438 AAGCCTGGGCTCCAGGGAAGGGG + Intergenic
1125709539 15:41773907-41773929 CAACCTGGTCATCATGAAAGGGG - Intergenic
1126190235 15:45871356-45871378 CACACAGGTCACCAGGGAAGTGG - Intergenic
1128798314 15:70480466-70480488 CACCCTGATCCCCAGAAATGAGG + Intergenic
1132206846 15:99992433-99992455 CACCTTGGTCCCCAGAAAACAGG + Intronic
1202983906 15_KI270727v1_random:391388-391410 CAGCCTGGTCTCCCGTACAGCGG - Intergenic
1133191486 16:4136704-4136726 CCGCCTTGTCTCCAGGAACGAGG - Intergenic
1137716995 16:50604052-50604074 CCCTCTGGCCTCCAGGACAGTGG - Intronic
1138297404 16:55898848-55898870 CACAGTGGTCTCTGGGAAAGTGG - Intronic
1138547281 16:57727452-57727474 CCCCCTGGTCTCCAGGGTGGTGG + Intronic
1138679809 16:58676430-58676452 CACCATGGTCTCCAGCAACTGGG + Intronic
1139643630 16:68311240-68311262 CACCCGGGCCTGCAGGAGAGCGG + Exonic
1140048128 16:71456182-71456204 CACCCTGTCCTGCAGGAAAGAGG - Intronic
1140137887 16:72224029-72224051 GACCCTGGTCTGCAGAAGAGAGG + Intergenic
1141294875 16:82758313-82758335 CATCCAGGTCTCCTGGAAATGGG + Intronic
1141661492 16:85443957-85443979 CCCCCTTGTCTCCCGGAACGTGG - Intergenic
1143298046 17:5885929-5885951 CACCTAGATCTCCAGGAAAGAGG + Intronic
1143361483 17:6375057-6375079 CAGGCTGCACTCCAGGAAAGAGG + Intergenic
1143501469 17:7341960-7341982 GGCACTGGTCTCCTGGAAAGTGG + Exonic
1146514472 17:33478638-33478660 CTCTCTGGTCTCCAGTAAAACGG - Intronic
1147214040 17:38888871-38888893 CAGCCTGGTCCCCAGGAAGAGGG - Intronic
1147534206 17:41308166-41308188 GACCCTGGACTGCAGGAAAGAGG + Exonic
1147644248 17:42024300-42024322 CAGCCTGGACTCCAGAAAAAGGG + Exonic
1149689716 17:58565093-58565115 CCCCCTGCTCTCCTGGGAAGAGG - Intronic
1150335480 17:64327508-64327530 CCTCCTGGCCTCCAGGAAGGGGG + Intronic
1150975164 17:70077749-70077771 TACCATGGTTTCCAGCAAAGGGG - Intronic
1151418941 17:73984951-73984973 AACCCTGGAGTCCAGGGAAGAGG - Intergenic
1151561662 17:74873053-74873075 CCCCCTGCGCTCCGGGAAAGCGG + Intergenic
1151743963 17:76001612-76001634 AAACGTGGACTCCAGGAAAGAGG - Intronic
1152073240 17:78144434-78144456 TTCCCTGGCCTCCAGGCAAGAGG + Intergenic
1152688275 17:81705582-81705604 CACCAAGGTCACCAGGCAAGAGG + Intronic
1155570187 18:27184776-27184798 CACCCTGGACTCCAGGATTCCGG - Intronic
1156893374 18:42215590-42215612 CATGCAGGTCTCCAGGGAAGTGG + Intergenic
1158532229 18:58273951-58273973 CAGCCTGGACTCCAGGGGAGGGG - Intronic
1159623831 18:70669487-70669509 CAGCCTGATCTCCATGAATGGGG + Intergenic
1160453770 18:78981294-78981316 CCCCCAGGGCGCCAGGAAAGAGG + Intronic
1160580128 18:79879030-79879052 CATCCGGGTCTCCAGGGAGGCGG - Intronic
1160686544 19:439342-439364 CACACTGGTCCCTGGGAAAGAGG - Intronic
1160909997 19:1469918-1469940 CTCCCTGGTCTCCAGGCTCGGGG - Exonic
1160929732 19:1564759-1564781 CTTCCTGGCCTCCAGGGAAGGGG + Intronic
1161880528 19:6947994-6948016 CATCCTCTTCTCCAGGAAACTGG - Intergenic
1166799017 19:45444427-45444449 AACACTGGTCTCCAGGCAACAGG + Intronic
1168616942 19:57845778-57845800 CACACTGGTCTCAAGGAATCTGG - Exonic
925650113 2:6080816-6080838 CTCCCTGAGCTCCAGGAAGGTGG + Intergenic
926166404 2:10524102-10524124 CAGCCTGGTCTCCAGCCACGTGG + Intergenic
927176834 2:20415765-20415787 CATACTGGTCGCCAGGGAAGTGG + Intergenic
927355435 2:22167599-22167621 CACACAGGTCACCAGGGAAGTGG - Intergenic
927721314 2:25384457-25384479 CACCCTGCTCTCCATCACAGGGG - Intronic
928547616 2:32343035-32343057 TATCCTGGTGTCCTGGAAAGAGG - Intergenic
928625273 2:33133470-33133492 CTGCCTAGTCTCCTGGAAAGAGG + Intronic
930333578 2:50017362-50017384 CCCCCTTGTCTCCATGAAAATGG + Intronic
931834615 2:66085632-66085654 CACACAGGTCACCAGGGAAGTGG - Intergenic
931899840 2:66776004-66776026 CTCCCTGGTCTCCAGATAGGTGG + Intergenic
931978419 2:67668309-67668331 CACCCTGGTTTCCTGGAAGGTGG - Intergenic
933537032 2:83588709-83588731 CATCCTGTTCTACATGAAAGGGG + Intergenic
935675527 2:105592313-105592335 CAGCCTGGGCCCCAGGGAAGAGG - Intergenic
936155013 2:110041619-110041641 ATCCCTGGTTACCAGGAAAGGGG + Intergenic
936189669 2:110329795-110329817 ATCCCTGGTTACCAGGAAAGGGG - Intergenic
936377309 2:111952968-111952990 CCCCCTGGTCTCATGGAAACAGG - Intronic
937017560 2:118619590-118619612 CACCCAAGCCTGCAGGAAAGTGG - Intergenic
937795821 2:126019024-126019046 CAGACTGGTCCCCAGGAAAGAGG - Intergenic
938854888 2:135299261-135299283 CATACAGGTCTCCAGGGAAGTGG + Intronic
938996367 2:136683157-136683179 CATACAGGTCACCAGGAAAGTGG - Intergenic
939026161 2:137015882-137015904 CTCCCTCCTCTCGAGGAAAGGGG - Intronic
940258468 2:151757067-151757089 CACGCTGTTCTCTAGGATAGTGG + Intergenic
941002709 2:160218641-160218663 CACCCTGGGATCCAGGAATGAGG + Intronic
941436645 2:165481396-165481418 CACCCCACACTCCAGGAAAGAGG - Intronic
945176505 2:207048812-207048834 CAACCTGGCCTCCAGGAGATAGG + Intergenic
947422059 2:229950059-229950081 CACCCTGAGCTCTAGGACAGGGG + Intronic
948628420 2:239284755-239284777 GACACTGGTCTCCAGGACACTGG - Intronic
948708275 2:239809333-239809355 GACCCTGGGCTCCAGGACACAGG - Intergenic
948858940 2:240743599-240743621 CACCGAGGACCCCAGGAAAGGGG - Intronic
1169329622 20:4706166-4706188 CACCCTGGGCACCTGGAATGTGG - Intergenic
1170779706 20:19413367-19413389 GTCCCTGGTCTCTAGGACAGTGG + Intronic
1170861221 20:20105315-20105337 CACCCTAGCCTCCTGGGAAGTGG - Intronic
1171771673 20:29326887-29326909 CAGCCTGATCCCCGGGAAAGAGG + Intergenic
1173708685 20:45135769-45135791 CACACACGTCTCCAGGAAACTGG - Intergenic
1173789069 20:45815920-45815942 CACCCTGGGCTCAAGGACTGAGG - Intronic
1174190304 20:48735652-48735674 CACGCTGCTCTCCTGGAATGGGG + Intronic
1174395912 20:50246840-50246862 TCTCCTGGTCTTCAGGAAAGGGG + Intergenic
1175130806 20:56788236-56788258 CACCCAGGCCTCCGGGAACGTGG - Intergenic
1175377880 20:58542034-58542056 CACCCAGGTCTCCAGGCTGGAGG - Intergenic
1177578870 21:22994079-22994101 CACCCGGGTTTCCAGGGAAGTGG - Intergenic
1178162814 21:29939136-29939158 CAATCTGGGCTCCAGGAACGCGG - Intronic
1180225262 21:46388369-46388391 CACCCTGTGCTCCAGGGGAGGGG + Intronic
1180825262 22:18857014-18857036 AGCCCTGGTCTGCAGGAAGGAGG + Intronic
1181187467 22:21117533-21117555 AGCCCTGGTCTGCAGGAAGGAGG - Intergenic
1181211731 22:21292960-21292982 AGCCCTGGTCTGCAGGAAGGAGG + Intergenic
1181275139 22:21683334-21683356 CCCCCTGACCTCCAGGAAAGCGG - Intronic
1181397777 22:22633926-22633948 AGCCCTGGTCTGCAGGAAGGAGG - Intergenic
1181500520 22:23313296-23313318 AGCCCTGGTCTGCAGGAAGGAGG - Intronic
1181532181 22:23522955-23522977 CACCACGGTCCCCAGGAAATTGG - Intergenic
1181567014 22:23745022-23745044 GACCCTTTTCTTCAGGAAAGAGG - Exonic
1181632452 22:24158280-24158302 CAGGCTGGTCTCCAGGAAGCAGG - Intronic
1181651634 22:24262132-24262154 AGCCCTGGTCTGCAGGAAGGAGG + Intergenic
1181705741 22:24648607-24648629 AGCCCTGGTCTGCAGGAAGGAGG - Intergenic
1182454541 22:30441555-30441577 CAGTCTAGTCTCCAGGCAAGAGG + Intergenic
1182483144 22:30622718-30622740 GACCATGGCCTCCAGGAAAGGGG - Intronic
1182574962 22:31266780-31266802 TGCCCAGCTCTCCAGGAAAGAGG + Intronic
1182751902 22:32648241-32648263 CTCCAAGCTCTCCAGGAAAGTGG - Intronic
1183586749 22:38757203-38757225 CACCGTGGTCTCCAGGAGGGTGG - Intronic
1183619573 22:38964714-38964736 CACCCTGGTCCCCTGTAAGGGGG - Intronic
1183640373 22:39089005-39089027 CACCCTGGTCCCCTGTAAGGGGG - Intergenic
1184319910 22:43733395-43733417 CACACTGGCCTCCAGGGCAGTGG + Intronic
1184585540 22:45445502-45445524 AAGCCTGGACGCCAGGAAAGTGG + Intergenic
1184655014 22:45936689-45936711 GACCCTGATGTCCAGGGAAGGGG + Intronic
1184995517 22:48204595-48204617 CACCCAGGTCTCCAGGCACCTGG - Intergenic
1203215222 22_KI270731v1_random:2472-2494 AGCCCTGGTCTGCAGGAAGGAGG - Intergenic
1203275411 22_KI270734v1_random:82917-82939 AGCCCTGGTCTGCAGGAAGGAGG + Intergenic
951750097 3:26025427-26025449 CACACAGGTCACCAGGGAAGTGG + Intergenic
952374966 3:32759342-32759364 CAATCTGGACACCAGGAAAGAGG - Intronic
952427883 3:33193890-33193912 CAGTCTGGTCCCCAGGCAAGTGG - Intronic
952568094 3:34682040-34682062 ACCCCTGGTCTCCATGAAAGTGG + Intergenic
953276698 3:41508171-41508193 CACGCAGGTCACCAGGGAAGTGG - Intronic
956611879 3:71132167-71132189 CAGCCTGGGCGCCATGAAAGTGG + Intronic
960028969 3:113038914-113038936 CAACCTAGGCTCCAGGAATGAGG + Intergenic
960368304 3:116802278-116802300 CAAGCTGGTTTCCAGGAAAATGG - Intronic
960758823 3:121049744-121049766 CCCTCACGTCTCCAGGAAAGGGG - Intronic
961774172 3:129272143-129272165 CACCTTGGTCAATAGGAAAGAGG + Intronic
962673765 3:137736392-137736414 CATACAGGTCACCAGGAAAGTGG + Intergenic
962925860 3:139992879-139992901 TAGTCTGGTCTCCAGGGAAGTGG - Intronic
962988771 3:140559814-140559836 CACCCTGGTCCCTAGTGAAGGGG + Intronic
963028872 3:140946842-140946864 TAGCCTGGAGTCCAGGAAAGAGG + Intronic
964226444 3:154408564-154408586 CACACAGGTCACCAGGAAAGTGG - Intronic
965061064 3:163786524-163786546 CATACAGGTTTCCAGGAAAGTGG + Intergenic
965391158 3:168106061-168106083 CATCCTCCTCTCCAGGAAATAGG - Intergenic
966426503 3:179785776-179785798 CACCCAGGTCTCCAGGCCATGGG - Exonic
966589426 3:181664656-181664678 CACCCTTGTCTCAATGTAAGAGG - Intergenic
967504572 3:190239190-190239212 CATACAGGTCACCAGGAAAGTGG - Intergenic
967998349 3:195183766-195183788 CACCCTGGTCCCCAGGAAAGGGG + Intronic
969363948 4:6683069-6683091 CACCCACAGCTCCAGGAAAGGGG + Intergenic
971909795 4:32781036-32781058 CAGTCTGGGCTCCAGGAAACTGG + Intergenic
973162955 4:47041306-47041328 CAAGTTGGTCTCCTGGAAAGAGG + Intronic
977513784 4:97995059-97995081 CACACAGGTCACCAGGAAAGTGG + Intronic
977610445 4:99024765-99024787 CAGTCTGGTCTCCAGGAAGAAGG + Intronic
980761444 4:137239007-137239029 CATACAGGTCGCCAGGAAAGTGG + Intergenic
982117383 4:152108948-152108970 CACTCTGAACTCCAGGAAGGAGG - Intergenic
983035868 4:162865042-162865064 CATGCAGGTCTCCAGGGAAGTGG - Intergenic
983754676 4:171320165-171320187 CACACTGGTCTCCAGGGAAATGG - Intergenic
989727449 5:44603814-44603836 CACACAGGTCACCAGGGAAGTGG - Intergenic
991091027 5:62694272-62694294 TCCCCTGGTCTCCAGAAAGGTGG + Intergenic
991622980 5:68565564-68565586 CACACAGGTTGCCAGGAAAGTGG - Intergenic
992444319 5:76820085-76820107 CACCCAGGTCTGCAGGCCAGAGG + Intronic
994034020 5:95178083-95178105 CACACAGGTCACCAGGGAAGTGG - Intronic
994428235 5:99622319-99622341 CACCCTGTACACCAGGAAACAGG + Intergenic
994887431 5:105582610-105582632 CATTCGGGTCTCTAGGAAAGTGG - Intergenic
995047477 5:107669229-107669251 CGCCCCGGGCTCCAGGAGAGAGG - Intronic
997798355 5:136834193-136834215 CACACAGGTCACCAGGGAAGTGG + Intergenic
998307774 5:141096299-141096321 CTCCCTGGTCTCCATCAACGCGG + Exonic
998311475 5:141136934-141136956 CTCCCTGGTCTCCATCAACGCGG + Exonic
998314942 5:141174338-141174360 CTCCCTGGTCTCCATCAACGCGG + Exonic
998316061 5:141184062-141184084 CTCCCTGGTCTCCATCAACGCGG + Exonic
998316616 5:141188821-141188843 CTCCCTGGTCTCCATCAACGCGG + Exonic
998317250 5:141194055-141194077 CTCCCTGGTCTCCATCAACGCGG + Exonic
998318879 5:141210410-141210432 CTCCCTGGTCTCCATCAACGCGG + Exonic
998321435 5:141236057-141236079 CTCCCTGGTCTCCATCAACGCGG + Intergenic
1000120186 5:158189817-158189839 CACACTGGTCCCCAGGTCAGTGG + Intergenic
1000394620 5:160760753-160760775 CATACAGGTCTCCAGGGAAGTGG - Intronic
1000415377 5:160978765-160978787 CTCCCTGGTCTCCAGAAACCAGG - Intergenic
1002196375 5:177503858-177503880 CACCCTGGCCTGCAGGAACAAGG - Exonic
1002660335 5:180787243-180787265 CAGGCTGGTCTCCAGGAAATAGG + Intergenic
1003519688 6:6847776-6847798 CATCCTGGTCACCTGGAATGTGG - Intergenic
1004422940 6:15487819-15487841 CACCCTGGGCTCCAGATGAGCGG + Intronic
1005296351 6:24431247-24431269 CACCCTGGTCCACAGGAACCTGG + Intronic
1006417075 6:33910950-33910972 CACCTTAGTTTCCAGGGAAGAGG - Intergenic
1007731458 6:43950134-43950156 CGTCCTGGACTCCAGGAAAGCGG - Intergenic
1007864656 6:44955461-44955483 CACGCAGGTCGCCAGGGAAGTGG - Intronic
1010470234 6:76218364-76218386 ATCCCTGGTCACCAGAAAAGGGG - Intergenic
1010801894 6:80186324-80186346 CATACTGGTCGCCAGGGAAGGGG + Intronic
1011633183 6:89346763-89346785 CAACCTGGTCTCTAGGGCAGTGG - Intronic
1013946594 6:115729152-115729174 CACCCAGGTCACCAGGGAAGTGG + Intergenic
1015635426 6:135269821-135269843 CACCCTGGGCTCCAGGCCAGGGG + Intergenic
1015944041 6:138482094-138482116 CACCCTGGTGTCAGGGAAAAGGG + Intronic
1018755266 6:166843121-166843143 CACACAGATCACCAGGAAAGTGG - Intronic
1019271877 7:154035-154057 CACCCTGGTCTGAAGGCAGGAGG + Intergenic
1021858196 7:24878924-24878946 CAGCCTGGTCTCCTGGAATGTGG - Intronic
1022131789 7:27411427-27411449 CACCCCGGTCCCCAGGATACCGG - Intergenic
1022805116 7:33813936-33813958 CATCCTGGTGCTCAGGAAAGAGG - Intergenic
1023154310 7:37232725-37232747 CAACCTGGTGTCCAGGGAAAAGG - Intronic
1024526876 7:50356845-50356867 CACCCTGGTCTCCAGGAGGTAGG - Intronic
1024551218 7:50564020-50564042 CACCCTGGTCTCCAGGAAAGGGG - Intronic
1024652197 7:51413811-51413833 AACGCTGGCCTCCAGAAAAGAGG - Intergenic
1025037372 7:55604426-55604448 AACGCTGGCCTCCAGAAAAGAGG - Intergenic
1026100496 7:67379990-67380012 CACCCAGATCTGCAGAAAAGTGG - Intergenic
1029401884 7:100352090-100352112 CCCCCTGCTGTCCAGGGAAGGGG + Intronic
1029549695 7:101231153-101231175 AAGCCTGGTATCCAGCAAAGTGG - Intergenic
1030455783 7:109772527-109772549 CACACAGGTCACCAGGGAAGTGG - Intergenic
1032189781 7:129757972-129757994 AATCATGGTCACCAGGAAAGTGG - Intergenic
1032782705 7:135176948-135176970 GCCCCTGGTCTCTATGAAAGTGG + Intergenic
1034051728 7:147990898-147990920 CAGCCTGATCTCCAGGGAGGAGG - Intronic
1034273115 7:149812682-149812704 CACCCTGCCCTCCCGCAAAGTGG - Intergenic
1034553999 7:151838351-151838373 CACCCTCGTCTCCAGCAGACGGG + Intronic
1035559531 8:594168-594190 CACCATGGCCTCCAAGAGAGCGG + Intergenic
1036682820 8:10887936-10887958 AACCCTGGGCTCAAGGAAAGGGG - Intergenic
1036699330 8:11001628-11001650 AACCCTCATCTCCAGGAATGGGG - Intronic
1037787685 8:21912304-21912326 CTCCTTGGTCTCCAGGAAGAAGG + Exonic
1038416105 8:27397242-27397264 CACCCTGGCACCCAGGCAAGGGG - Intronic
1040967038 8:53093109-53093131 CACACAGGTCACTAGGAAAGTGG + Intergenic
1048234306 8:132675197-132675219 GGCACTGGACTCCAGGAAAGGGG - Intronic
1048937560 8:139369612-139369634 GACCTTGGACTCCAGGACAGAGG - Intergenic
1049182636 8:141230901-141230923 CACCCGGGGATCCAGGAATGCGG + Intronic
1049440840 8:142608878-142608900 CACTCTGTTCCCAAGGAAAGAGG - Intergenic
1049790429 8:144469864-144469886 AACCCTGGACCCCAGCAAAGGGG - Intronic
1050114909 9:2253760-2253782 AAGCCTGTTCTCCAGGGAAGTGG - Intergenic
1052006674 9:23357710-23357732 CACACTGGTCACCAGGGAAGTGG + Intergenic
1052824238 9:33163715-33163737 CACCCAGGTGGCCAGAAAAGAGG + Intronic
1059191447 9:112331292-112331314 CACCCTGGTCTTAAGGGATGTGG - Intronic
1060817198 9:126641215-126641237 TCCCCTGTGCTCCAGGAAAGGGG - Intronic
1061619916 9:131805162-131805184 CATCCTGGTCTCCAGGATACAGG + Intergenic
1062290927 9:135794023-135794045 CACCCTGGCCCCCAGGCGAGGGG + Intergenic
1062292909 9:135805381-135805403 CACCATGTTCTCAAGGGAAGGGG - Intergenic
1062677093 9:137753010-137753032 CACCCTGGTCTGCGGGAATTGGG + Intronic
1186200302 X:7149218-7149240 GACCCTGTTCTCCACAAAAGGGG + Intergenic
1188764298 X:34073489-34073511 CTCCCTGGTTTTTAGGAAAGTGG + Intergenic
1189058617 X:37727816-37727838 CACCCAGGTCTTCAGGACGGAGG - Exonic
1191797443 X:65035451-65035473 AACCCTGGCGTCCAGGAATGCGG + Intergenic
1192853023 X:74977669-74977691 CATACAGGTCTCCAGGGAAGTGG + Intergenic
1192875978 X:75230145-75230167 CATACAGGTCACCAGGAAAGTGG - Intergenic
1193016678 X:76741467-76741489 CATACTGGTCTCCATGAAAGCGG - Intergenic
1193196927 X:78643484-78643506 CACACAGGTCACCAGGGAAGTGG - Intergenic
1193632101 X:83901979-83902001 CACACAGGTCACCAGGAAAGTGG + Intergenic
1196023999 X:111020891-111020913 CACACAGGTCACCAGGGAAGTGG - Intronic
1198604563 X:138322550-138322572 CATACAGGTCTCCAGGGAAGTGG + Intergenic
1198754556 X:139969430-139969452 CACCCTTGTGGCCAGGAGAGAGG - Intergenic
1199947438 X:152680280-152680302 CACCCAGGACCCCAGGACAGGGG + Intergenic
1199962242 X:152788174-152788196 CACCCAGGACCCCAGGACAGGGG - Intergenic
1200223152 X:154401981-154402003 AACCCAGGTGTCCCGGAAAGGGG - Exonic
1202084430 Y:21121077-21121099 CACCCTCTTCTCCAGGAATCTGG + Intergenic