ID: 1024553727

View in Genome Browser
Species Human (GRCh38)
Location 7:50584974-50584996
Sequence GTGCAAACCCACAGATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024553727_1024553730 -9 Left 1024553727 7:50584974-50584996 CCCAGAGATCTGTGGGTTTGCAC No data
Right 1024553730 7:50584988-50585010 GGTTTGCACAGCCCTCCAGGTGG No data
1024553727_1024553732 2 Left 1024553727 7:50584974-50584996 CCCAGAGATCTGTGGGTTTGCAC No data
Right 1024553732 7:50584999-50585021 CCCTCCAGGTGGCTGATGAGCGG No data
1024553727_1024553734 3 Left 1024553727 7:50584974-50584996 CCCAGAGATCTGTGGGTTTGCAC No data
Right 1024553734 7:50585000-50585022 CCTCCAGGTGGCTGATGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024553727 Original CRISPR GTGCAAACCCACAGATCTCT GGG (reversed) Intergenic
No off target data available for this crispr